ID: 1185619296

View in Genome Browser
Species Human (GRCh38)
Location X:1443643-1443665
Sequence GCGGTGTGTGTCCATGATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619296_1185619304 23 Left 1185619296 X:1443643-1443665 CCGCCATCATGGACACACACCGC No data
Right 1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG No data
1185619296_1185619301 4 Left 1185619296 X:1443643-1443665 CCGCCATCATGGACACACACCGC No data
Right 1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619296 Original CRISPR GCGGTGTGTGTCCATGATGG CGG (reversed) Intronic