ID: 1185619297

View in Genome Browser
Species Human (GRCh38)
Location X:1443646-1443668
Sequence ATGGCGGTGTGTGTCCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619297_1185619301 1 Left 1185619297 X:1443646-1443668 CCATCATGGACACACACCGCCAT No data
Right 1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG No data
1185619297_1185619305 29 Left 1185619297 X:1443646-1443668 CCATCATGGACACACACCGCCAT No data
Right 1185619305 X:1443698-1443720 CACTGCCATCTTGGCCATCGTGG No data
1185619297_1185619304 20 Left 1185619297 X:1443646-1443668 CCATCATGGACACACACCGCCAT No data
Right 1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619297 Original CRISPR ATGGCGGTGTGTGTCCATGA TGG (reversed) Intronic