ID: 1185619298

View in Genome Browser
Species Human (GRCh38)
Location X:1443651-1443673
Sequence ATGGACACACACCGCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619294_1185619298 1 Left 1185619294 X:1443627-1443649 CCATCGTGGACAGACACCGCCAT No data
Right 1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG No data
1185619293_1185619298 4 Left 1185619293 X:1443624-1443646 CCGCCATCGTGGACAGACACCGC No data
Right 1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG No data
1185619290_1185619298 23 Left 1185619290 X:1443605-1443627 CCGCCATCGTGGACAGACACCGC No data
Right 1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG No data
1185619291_1185619298 20 Left 1185619291 X:1443608-1443630 CCATCGTGGACAGACACCGCCAT No data
Right 1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619298 Original CRISPR ATGGACACACACCGCCATCA TGG Intronic