ID: 1185619298

View in Genome Browser
Species Human (GRCh38)
Location X:1443651-1443673
Sequence ATGGACACACACCGCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 6, 2: 23, 3: 32, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619294_1185619298 1 Left 1185619294 X:1443627-1443649 CCATCGTGGACAGACACCGCCAT 0: 2
1: 7
2: 35
3: 50
4: 120
Right 1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG 0: 1
1: 6
2: 23
3: 32
4: 101
1185619291_1185619298 20 Left 1185619291 X:1443608-1443630 CCATCGTGGACAGACACCGCCAT 0: 2
1: 7
2: 35
3: 50
4: 120
Right 1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG 0: 1
1: 6
2: 23
3: 32
4: 101
1185619290_1185619298 23 Left 1185619290 X:1443605-1443627 CCGCCATCGTGGACAGACACCGC 0: 3
1: 4
2: 25
3: 23
4: 118
Right 1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG 0: 1
1: 6
2: 23
3: 32
4: 101
1185619293_1185619298 4 Left 1185619293 X:1443624-1443646 CCGCCATCGTGGACAGACACCGC 0: 3
1: 4
2: 25
3: 23
4: 118
Right 1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG 0: 1
1: 6
2: 23
3: 32
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619298 Original CRISPR ATGGACACACACCGCCATCA TGG Intronic
906054072 1:42900549-42900571 CTGAACACACACCGCCACCAGGG - Intergenic
910015906 1:82522922-82522944 AATGACACACACAACCATCAAGG - Intergenic
921196234 1:212760383-212760405 GTGCACACACTCAGCCATCAAGG + Intronic
923121706 1:230998255-230998277 AGGGACACAGACCCCCGTCAGGG + Intronic
924700964 1:246451682-246451704 ATGGACACCCCCCGCCAGAATGG - Intronic
1064467317 10:15597234-15597256 AAGGTCACACACCACCATCCTGG + Exonic
1090673648 11:128969643-128969665 ATGGACAGAGCCCACCATCACGG - Exonic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1095665375 12:44790835-44790857 ATGGACACAAAAAGCCAGCAAGG + Intronic
1098377798 12:69836184-69836206 ATGGACCCACACCGGCATGCCGG - Intronic
1098379250 12:69851798-69851820 ACAGACACACACCACCATCTTGG + Intronic
1102032935 12:109753413-109753435 ATACATACACACCCCCATCAGGG - Intronic
1102473195 12:113171755-113171777 ATGGACACACACCAAAATGACGG + Intronic
1111552505 13:89833347-89833369 ATGGACTCACTTGGCCATCAGGG - Intergenic
1118809891 14:69265400-69265422 AAGGACAAACACAGCCACCATGG - Intronic
1121110084 14:91306824-91306846 AGGGGCACACACAGCCTTCATGG - Intronic
1121278711 14:92685312-92685334 CTGGACACACACTGGCAGCAGGG - Intronic
1123488373 15:20760954-20760976 CTGGGAACACACAGCCATCAGGG - Intergenic
1123544870 15:21330027-21330049 CTGGGAACACACAGCCATCAGGG - Intergenic
1123797115 15:23783203-23783225 ATGCAGATACTCCGCCATCAGGG - Intergenic
1125070771 15:35550317-35550339 ATGGACACAAACTGCAGTCACGG - Intergenic
1125550564 15:40541472-40541494 ATGGGCACACACCACCAACCCGG + Intronic
1127962591 15:63900775-63900797 ATGGACACACAGGGGCACCAGGG + Intergenic
1131307693 15:91259761-91259783 ATGGAGACACAGAGGCATCAGGG - Intronic
1202953216 15_KI270727v1_random:57298-57320 CTGGGAACACACAGCCATCAGGG - Intergenic
1133757765 16:8775572-8775594 ACACACACACACAGCCATCAGGG + Intronic
1136551462 16:30984557-30984579 AGGGACCCACCCCGCCATCCTGG - Exonic
1137769247 16:51003118-51003140 CTGGAAACACAACGCCACCAAGG - Intergenic
1141472168 16:84246463-84246485 ATCTATACACACCGCCGTCAAGG + Intergenic
1142407015 16:89895935-89895957 ATGGCCACACACAGCAACCACGG - Intronic
1149254647 17:54811882-54811904 ATGGATACACACAGACATTAAGG + Intergenic
1150313195 17:64146310-64146332 AACGACACACACCGACACCAGGG - Intergenic
1152622791 17:81373636-81373658 ATGGGCACACAGGGCCAGCATGG - Intergenic
1153779758 18:8484125-8484147 ATAAACACACACCAACATCAAGG + Intergenic
1154158402 18:11961202-11961224 CTGGACACACACCCACTTCAGGG - Intergenic
1160016436 18:75144390-75144412 ATGAACACACACCCCCATGTAGG - Intergenic
1160622082 18:80178778-80178800 ATGGACACATGCCGACAGCATGG + Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1165121617 19:33562672-33562694 ATGGACTCACAACGCCCTCCTGG - Intergenic
1168334879 19:55592061-55592083 ATGGGCACCCACCCCCACCAAGG - Exonic
925024535 2:597292-597314 CTGGGGACACACCACCATCAAGG + Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
927727597 2:25438649-25438671 ATGGACATACTCTGCCCTCAAGG + Intronic
930035511 2:47083002-47083024 ATGGTCACTGAGCGCCATCAAGG - Intronic
936024602 2:109021694-109021716 ATGGACACACACTGCCTGCGAGG - Intergenic
1170356984 20:15503729-15503751 ATGGACAGACACAGTCATGATGG - Intronic
1173882989 20:46432969-46432991 ATGGACACGTACATCCATCATGG - Intronic
1175908638 20:62394116-62394138 GTGGACACCCAGCGCCGTCAGGG - Intronic
1178508304 21:33180813-33180835 AGGGTCACACACCGGAATCATGG - Intergenic
1180090160 21:45529994-45530016 ATGGACACACACCACACACACGG - Intronic
1181339502 22:22166507-22166529 AGGGACACACACAGCAATCCTGG - Intergenic
1183265861 22:36824578-36824600 ACGGACACACACCTCTGTCAAGG - Intergenic
1184994941 22:48198839-48198861 ATGGAAGCACACCGGCACCAGGG + Intergenic
1185175799 22:49325832-49325854 CTGGGCTCACACCGCCAGCACGG - Intergenic
953575956 3:44113420-44113442 ATGGACACACTTAACCATCACGG - Intergenic
962102454 3:132356834-132356856 ATGACCACAAACAGCCATCAAGG + Exonic
968893942 4:3387987-3388009 AGGGACACACAGAGCCAGCACGG - Intronic
969318904 4:6398925-6398947 ATTGACACACACAGCAACCAGGG + Intronic
970207762 4:13672709-13672731 ATGGAAAAGCAGCGCCATCAGGG + Intergenic
972871114 4:43299503-43299525 ATGGAACCACATTGCCATCAAGG + Intergenic
986369605 5:7066930-7066952 ATGGAGAGACAGCGCCAGCAAGG + Intergenic
991767688 5:70004957-70004979 TGGAACACTCACCGCCATCACGG + Intergenic
991846922 5:70880033-70880055 TGGAACACTCACCGCCATCACGG + Intergenic
997661898 5:135595403-135595425 ATGGACAGGCACCGCCAACCAGG + Intergenic
998550573 5:143073690-143073712 ATGTACACACACTGCAGTCAAGG + Intronic
1000064398 5:157682600-157682622 AGGGACACACACAGCCTTCCAGG - Intergenic
1001709715 5:173768470-173768492 ATGGATGCCCACTGCCATCACGG - Intergenic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1003583587 6:7365343-7365365 AGGGTCACACACTGGCATCATGG - Intronic
1010450254 6:75994523-75994545 ATGGACTCACAGTTCCATCATGG + Intronic
1010625296 6:78131248-78131270 ATGGAAACACACTGCCATGAAGG + Intergenic
1011274080 6:85611651-85611673 CTGGACACTCACTGTCATCAAGG + Intronic
1012914587 6:105155890-105155912 TTGGCCACACATTGCCATCATGG - Intergenic
1015711469 6:136146083-136146105 TTGGTCACTCACTGCCATCAGGG + Intronic
1020105166 7:5419463-5419485 ATGCACACACACACACATCACGG + Intronic
1022842276 7:34176085-34176107 ATGGACACACATAGACATCAGGG - Intergenic
1023924497 7:44656165-44656187 AGGGACACACACACACATCAAGG - Intronic
1026595036 7:71727269-71727291 CTGCACACACACCCCCACCATGG - Intergenic
1032329288 7:130962728-130962750 ATGGACACACTTAGCCAGCACGG - Intergenic
1041905725 8:63031529-63031551 ATGGGCAACCATCGCCATCAGGG + Intronic
1043284552 8:78513585-78513607 ATGTACACACTCTGCCCTCAGGG + Intergenic
1048555281 8:135469844-135469866 ATGCACAGAGACTGCCATCAAGG + Intronic
1048890310 8:138941063-138941085 ATGGACACACACTCACAACATGG - Intergenic
1049529773 8:143148396-143148418 ATGGGCACCCACCCCCATCATGG + Intergenic
1050035196 9:1427972-1427994 ATGAAGAAACACCACCATCAGGG + Intergenic
1058417885 9:104806805-104806827 ATGGGCATACACCTCCATGAAGG - Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1191079833 X:56498050-56498072 ATGGAAACACACACACATCAGGG - Intergenic
1200974273 Y:9191922-9191944 ATGGAACCACATAGCCATCAGGG - Intergenic
1201264385 Y:12192016-12192038 AAGGACACAACCCTCCATCAGGG + Intergenic
1202136603 Y:21671710-21671732 ATGGAACCACATAGCCATCAGGG + Intergenic