ID: 1185619301

View in Genome Browser
Species Human (GRCh38)
Location X:1443670-1443692
Sequence ATGGACACACACCGCCATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619294_1185619301 20 Left 1185619294 X:1443627-1443649 CCATCGTGGACAGACACCGCCAT No data
Right 1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG No data
1185619296_1185619301 4 Left 1185619296 X:1443643-1443665 CCGCCATCATGGACACACACCGC No data
Right 1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG No data
1185619293_1185619301 23 Left 1185619293 X:1443624-1443646 CCGCCATCGTGGACAGACACCGC No data
Right 1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG No data
1185619297_1185619301 1 Left 1185619297 X:1443646-1443668 CCATCATGGACACACACCGCCAT No data
Right 1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619301 Original CRISPR ATGGACACACACCGCCATCG TGG Intronic