ID: 1185619301

View in Genome Browser
Species Human (GRCh38)
Location X:1443670-1443692
Sequence ATGGACACACACCGCCATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 6, 2: 27, 3: 26, 4: 52}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619293_1185619301 23 Left 1185619293 X:1443624-1443646 CCGCCATCGTGGACAGACACCGC 0: 3
1: 4
2: 25
3: 23
4: 118
Right 1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG 0: 1
1: 6
2: 27
3: 26
4: 52
1185619296_1185619301 4 Left 1185619296 X:1443643-1443665 CCGCCATCATGGACACACACCGC 0: 5
1: 14
2: 18
3: 29
4: 207
Right 1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG 0: 1
1: 6
2: 27
3: 26
4: 52
1185619297_1185619301 1 Left 1185619297 X:1443646-1443668 CCATCATGGACACACACCGCCAT 0: 5
1: 22
2: 28
3: 52
4: 249
Right 1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG 0: 1
1: 6
2: 27
3: 26
4: 52
1185619294_1185619301 20 Left 1185619294 X:1443627-1443649 CCATCGTGGACAGACACCGCCAT 0: 2
1: 7
2: 35
3: 50
4: 120
Right 1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG 0: 1
1: 6
2: 27
3: 26
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619301 Original CRISPR ATGGACACACACCGCCATCG TGG Intronic
900739224 1:4320539-4320561 ATGCACACACACAGGCACCGGGG - Intergenic
906054072 1:42900549-42900571 CTGAACACACACCGCCACCAGGG - Intergenic
1064467317 10:15597234-15597256 AAGGTCACACACCACCATCCTGG + Exonic
1074873253 10:117594564-117594586 AGGGAGCCACACCGCCATTGTGG + Intergenic
1077220023 11:1411666-1411688 ATGAACACACTCCTCCCTCGAGG - Intronic
1089015148 11:115159489-115159511 ATGGACACACACCAGGCTCGAGG + Intergenic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1098377798 12:69836184-69836206 ATGGACCCACACCGGCATGCCGG - Intronic
1098379250 12:69851798-69851820 ACAGACACACACCACCATCTTGG + Intronic
1115489922 14:33949559-33949581 ATGGACATGCACCAACATCGCGG + Intronic
1117671318 14:58109434-58109456 ATGGAAACACACTGCTATAGAGG - Intronic
1125550564 15:40541472-40541494 ATGGGCACACACCACCAACCCGG + Intronic
1136551462 16:30984557-30984579 AGGGACCCACCCCGCCATCCTGG - Exonic
1136932552 16:34432315-34432337 ATGGGCACACACAGCCACAGAGG - Intergenic
1136972020 16:34979499-34979521 ATGGGCACACACAGCCACAGAGG + Intergenic
1160016436 18:75144390-75144412 ATGAACACACACCCCCATGTAGG - Intergenic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1165121617 19:33562672-33562694 ATGGACTCACAACGCCCTCCTGG - Intergenic
1165378499 19:35460957-35460979 ATGGAGACTGACCTCCATCGAGG + Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
936024602 2:109021694-109021716 ATGGACACACACTGCCTGCGAGG - Intergenic
948737689 2:240020091-240020113 ATGGACACACACTGCATCCGTGG + Intronic
1175728117 20:61333287-61333309 ATGCACACACACCTGCATGGGGG + Intronic
1181339502 22:22166507-22166529 AGGGACACACACAGCAATCCTGG - Intergenic
1183477493 22:38043477-38043499 ATGCACACACACTCCCATTGGGG + Intergenic
968893950 4:3388036-3388058 AGGGACACACAGAGCCAGCGTGG - Intronic
997661898 5:135595403-135595425 ATGGACAGGCACCGCCAACCAGG + Intergenic
1000064398 5:157682600-157682622 AGGGACACACACAGCCTTCCAGG - Intergenic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1009461783 6:63922024-63922046 ATTTACACACACAGCCTTCGAGG + Intronic
1010625296 6:78131248-78131270 ATGGAAACACACTGCCATGAAGG + Intergenic
1019307316 7:341985-342007 CTGGACACACAGCCACATCGAGG - Intergenic
1022842276 7:34176085-34176107 ATGGACACACATAGACATCAGGG - Intergenic
1047037010 8:120950969-120950991 ACACACACACACCGCCATAGTGG + Intergenic
1049529773 8:143148396-143148418 ATGGGCACCCACCCCCATCATGG + Intergenic
1049621393 8:143599814-143599836 CTGGTCACACACCGTCATAGGGG - Exonic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619214 X:1443093-1443115 TGGGACACACACCGTCGTCGTGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1189695752 X:43660116-43660138 ATGTACACACACAGACATAGAGG - Intronic