ID: 1185619308

View in Genome Browser
Species Human (GRCh38)
Location X:1443717-1443739
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 2, 1: 1, 2: 8, 3: 45, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619302_1185619308 13 Left 1185619302 X:1443681-1443703 CCGCCATCGTGGACACACACTGC 0: 2
1: 3
2: 25
3: 35
4: 169
Right 1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG 0: 2
1: 1
2: 8
3: 45
4: 120
1185619306_1185619308 -9 Left 1185619306 X:1443703-1443725 CCATCTTGGCCATCGTGGACACA 0: 2
1: 1
2: 1
3: 12
4: 309
Right 1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG 0: 2
1: 1
2: 8
3: 45
4: 120
1185619303_1185619308 10 Left 1185619303 X:1443684-1443706 CCATCGTGGACACACACTGCCAT 0: 2
1: 8
2: 44
3: 60
4: 198
Right 1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG 0: 2
1: 1
2: 8
3: 45
4: 120
1185619300_1185619308 29 Left 1185619300 X:1443665-1443687 CCATCATGGACACACACCGCCAT 0: 5
1: 22
2: 28
3: 52
4: 249
Right 1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG 0: 2
1: 1
2: 8
3: 45
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901846517 1:11986406-11986428 GTGCACACACCCCCTCATCCAGG + Intronic
908113275 1:60917810-60917832 GTGGACACAAATCCACATAGAGG - Intronic
918512957 1:185331293-185331315 GTGGACAGACACCTGCAGCGAGG + Intergenic
919791074 1:201291395-201291417 GTGGACACACAGACACATGGAGG - Intronic
919938731 1:202271924-202271946 GAGGACAAACACCCCCTTAGAGG - Intronic
920088023 1:203432309-203432331 GTGGAAAGACACCCCCAGCCAGG - Intergenic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1076817412 10:132921706-132921728 GAGGACACAGACCCCCAGAGGGG + Intronic
1076868732 10:133182357-133182379 GTGGACACGCACCTGCATCCTGG - Intronic
1077383707 11:2259325-2259347 GTGGGCACATACCCCCATGAGGG - Intergenic
1084114570 11:67034585-67034607 GTGGATACAGACCCCCACCCGGG - Intronic
1084519828 11:69656358-69656380 GTGTACAGACACCCCCATTGTGG - Intronic
1084519842 11:69656399-69656421 GTGTACAGACCCCCCCATCGTGG - Intronic
1088239410 11:107758406-107758428 CTGAACACACACCCCCACTGGGG + Intergenic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1093010419 12:14101383-14101405 CTGAACACACACCCCCACTGAGG + Intergenic
1103600410 12:122051047-122051069 GGAGACACACACCCCCAACGTGG - Intronic
1106251712 13:27986974-27986996 GTGGACACTCACCCACTTCTGGG - Intronic
1112388587 13:98962434-98962456 GTGGACACACGACCCTATCAGGG - Intronic
1113639055 13:111944286-111944308 GAGGACCCACACCCCCATGCAGG + Intergenic
1113947895 13:114054919-114054941 GTGGGCACACACACCCCTGGGGG - Intronic
1114823495 14:26050137-26050159 GTGGACACAAAACCTCATCTGGG - Intergenic
1115159705 14:30380087-30380109 GTGCACACTCATCCCCATGGAGG + Intergenic
1115969696 14:38931998-38932020 CTGAACACACACCCCAACCGGGG + Intergenic
1116335441 14:43651147-43651169 CTGAACACACACCCCCACTGGGG + Intergenic
1117193523 14:53316993-53317015 CTGAACACACACCCCCACTGGGG - Intergenic
1122319725 14:100846677-100846699 GTGTACACACACTCTCATCCTGG - Intergenic
1124553996 15:30708918-30708940 GTGGGCACCCACCCCCATCTGGG + Intronic
1124677251 15:31696753-31696775 GTGGGCACCCACCCCCATCTGGG - Intronic
1130903866 15:88226461-88226483 CTGGAGACCCACCCCCATTGTGG - Intronic
1142314713 16:89336351-89336373 GTGGACGCACACCCGCCTCTAGG - Intronic
1142397848 16:89842820-89842842 GGGGACCCACACCCCCACCGTGG + Intronic
1144750314 17:17644065-17644087 TTGGACACACACACACATAGAGG + Intergenic
1148746876 17:49923500-49923522 GGGGACCCCCACCCCCATCAAGG + Intergenic
1151314094 17:73311428-73311450 GCGCACACACGCCCCCCTCGCGG + Intronic
1152702349 17:81825350-81825372 GAGGACACACAACCCCAAGGTGG + Exonic
1153169084 18:2294093-2294115 CTGAACACACTCCCCCATTGGGG - Intergenic
1154158402 18:11961202-11961224 CTGGACACACACCCACTTCAGGG - Intergenic
1156162384 18:34374687-34374709 CTGGACACACACCCCTAAAGTGG + Intergenic
1156682978 18:39613491-39613513 GAGGACACACACACCCACCCGGG - Intergenic
1158106131 18:53887083-53887105 GTGGACTCACACACCCATATGGG - Intergenic
1160016436 18:75144390-75144412 ATGAACACACACCCCCATGTAGG - Intergenic
1161152033 19:2714636-2714658 GTGCCCCCACTCCCCCATCGTGG - Exonic
1161490649 19:4559430-4559452 GTGGAGACACTCTCCCATCCAGG + Intronic
1164237737 19:23351840-23351862 CTGAACACACACCCCCATACAGG + Intronic
1164443132 19:28294576-28294598 GAGGACACACACACCCAACCTGG + Intergenic
1165274111 19:34733499-34733521 GAGGACACAGACCCTCATCCTGG - Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
925703057 2:6658438-6658460 GTGGACACAGACACCCATACAGG + Intergenic
932954756 2:76337921-76337943 CTGAACACACACCCCCACTGGGG - Intergenic
935945305 2:108280762-108280784 GTGGCCACACACCTCGATGGTGG + Intergenic
937767742 2:125680768-125680790 CTGAACACACACCCCCACTGGGG - Intergenic
938246581 2:129781958-129781980 CAGGACACACATCCCCATGGAGG - Intergenic
939003699 2:136763623-136763645 CTGCACACACACCCCCATATGGG - Intergenic
944432184 2:199645281-199645303 CTGAACACACACCCCCACTGGGG - Intergenic
1168970993 20:1930533-1930555 GTGGCTACACAGCCCCATCTAGG + Intronic
1171160418 20:22917024-22917046 CTGAACACACACCCCCACTGGGG - Intergenic
1172098290 20:32471273-32471295 GTGGACACTCACCCCGGTAGAGG + Intronic
1173548768 20:43917459-43917481 GTGGACACACCCACACATGGGGG + Intronic
1175841431 20:62030111-62030133 GTGGCCGCACACCCCTATCGGGG - Intronic
1181023570 22:20115633-20115655 GTGGCCACAAACCCCTATCCTGG - Intronic
1183477493 22:38043477-38043499 ATGCACACACACTCCCATTGGGG + Intergenic
1183507038 22:38214992-38215014 GTGCACACACATTCCCTTCGTGG + Exonic
1183912804 22:41091984-41092006 GTCCGCACACACCCCCACCGCGG + Exonic
950414343 3:12860125-12860147 GTGGACCCTCACCCCCAAAGTGG - Intronic
961019902 3:123496808-123496830 GTGTTCACACAACCCCATAGTGG + Intronic
962790833 3:138810255-138810277 GTGTAGATACACCCCCATCAAGG + Intronic
964060627 3:152518026-152518048 GTGGACATACACACACATCCAGG - Intergenic
968067889 3:195768936-195768958 CTGCACACACACTCCCATCCTGG - Intronic
973159075 4:46993567-46993589 GTGCACACACACGCCCACCGCGG - Exonic
977337801 4:95720185-95720207 GTTGATACCCACCCCCATTGGGG + Intergenic
980195172 4:129578706-129578728 CTGAACACACACCCCCACTGGGG - Intergenic
980913483 4:139014031-139014053 GTGATTACACACCCCCAACGGGG - Intergenic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
989669210 5:43894762-43894784 GTGCACACACCCACCCATCCTGG + Intergenic
1002136207 5:177109241-177109263 GTGGACACAGAGCCACATGGGGG + Intergenic
1002437777 5:179242712-179242734 TTGGCCACACACCCCCAGAGTGG - Intronic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1002780828 6:364583-364605 GTGGACAGACACCCATCTCGTGG + Intergenic
1011833622 6:91403910-91403932 CTGAACACACACCCCCACTGGGG + Intergenic
1012965503 6:105669023-105669045 CTGAACACACATCCCCATTGGGG + Intergenic
1017269588 6:152491000-152491022 GTGGACACAAAACTCCAGCGTGG + Intronic
1017632176 6:156407117-156407139 GTCGACACACACCCATATTGTGG - Intergenic
1018390010 6:163335113-163335135 GTGGACACAGACCCACATGCAGG + Intergenic
1019256835 7:57677-57699 GTGCACACACAGCCACATGGAGG + Intergenic
1019307316 7:341985-342007 CTGGACACACAGCCACATCGAGG - Intergenic
1026595036 7:71727269-71727291 CTGCACACACACCCCCACCATGG - Intergenic
1031827866 7:126588832-126588854 GTGAACACACACCCTCACTGGGG + Intronic
1034269919 7:149798441-149798463 GTGGCCTCCCACCCCCATGGGGG - Intergenic
1034750527 7:153564368-153564390 GTGGAGACACAGCCCCTTGGAGG + Intergenic
1035245148 7:157558388-157558410 GAGCACACACACCCACATGGGGG + Intronic
1044657259 8:94561518-94561540 CTGGACACACATCCCCACTGGGG - Intergenic
1045337497 8:101221753-101221775 GTACACACACACACCCATCTTGG - Intergenic
1046728968 8:117704880-117704902 GTGGGTACACACCCCCATAGTGG - Intergenic
1049529773 8:143148396-143148418 ATGGGCACCCACCCCCATCATGG + Intergenic
1050799955 9:9598229-9598251 GTGGACACAGTCCCACATCAGGG + Intronic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1060799216 9:126533019-126533041 GGGCACACACACCCCGCTCGCGG - Intergenic
1061548356 9:131317838-131317860 CTGGGCACACAGCCCCCTCGAGG - Intergenic
1062143130 9:134971284-134971306 TTGGACTCTCACCCCCATTGTGG - Intergenic
1062263637 9:135676455-135676477 GGGGCCACACACCCCCATGCCGG + Intergenic
1062290802 9:135793537-135793559 GTGCACACACATCCCCACCTGGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1191692222 X:63952387-63952409 CTGAACACACACCCCCAACTGGG + Intergenic
1198211349 X:134519247-134519269 TTGGACACAGACACCCATAGAGG - Intronic
1200954529 Y:8930416-8930438 GTGGACACACCCACCCCTCAGGG - Intergenic
1201969300 Y:19774131-19774153 GTATACACACACACCCATGGAGG + Intergenic
1202232657 Y:22671811-22671833 GTGGACACACCCACCCCTCAGGG - Intergenic
1202310499 Y:23524347-23524369 GTGGACACACCCACCCCTCAGGG + Intergenic
1202560303 Y:26146247-26146269 GTGGACACACCCACCCCTCAGGG - Intergenic