ID: 1185619310

View in Genome Browser
Species Human (GRCh38)
Location X:1443729-1443751
Sequence GATGATGTCTGTCCACGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619310_1185619315 9 Left 1185619310 X:1443729-1443751 CCCCATCGTGGACAGACATCATC No data
Right 1185619315 X:1443761-1443783 CACTGCCATCTTGGCCATCGTGG No data
1185619310_1185619314 0 Left 1185619310 X:1443729-1443751 CCCCATCGTGGACAGACATCATC No data
Right 1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG No data
1185619310_1185619318 28 Left 1185619310 X:1443729-1443751 CCCCATCGTGGACAGACATCATC No data
Right 1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619310 Original CRISPR GATGATGTCTGTCCACGATG GGG (reversed) Intronic