ID: 1185619312

View in Genome Browser
Species Human (GRCh38)
Location X:1443731-1443753
Sequence ACGATGATGTCTGTCCACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619312_1185619315 7 Left 1185619312 X:1443731-1443753 CCATCGTGGACAGACATCATCGT No data
Right 1185619315 X:1443761-1443783 CACTGCCATCTTGGCCATCGTGG No data
1185619312_1185619314 -2 Left 1185619312 X:1443731-1443753 CCATCGTGGACAGACATCATCGT No data
Right 1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG No data
1185619312_1185619318 26 Left 1185619312 X:1443731-1443753 CCATCGTGGACAGACATCATCGT No data
Right 1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619312 Original CRISPR ACGATGATGTCTGTCCACGA TGG (reversed) Intronic