ID: 1185619314

View in Genome Browser
Species Human (GRCh38)
Location X:1443752-1443774
Sequence GTGGACACACACTGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619311_1185619314 -1 Left 1185619311 X:1443730-1443752 CCCATCGTGGACAGACATCATCG No data
Right 1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG No data
1185619312_1185619314 -2 Left 1185619312 X:1443731-1443753 CCATCGTGGACAGACATCATCGT No data
Right 1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG No data
1185619309_1185619314 1 Left 1185619309 X:1443728-1443750 CCCCCATCGTGGACAGACATCAT No data
Right 1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG No data
1185619307_1185619314 17 Left 1185619307 X:1443712-1443734 CCATCGTGGACACACACCCCCAT No data
Right 1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG No data
1185619310_1185619314 0 Left 1185619310 X:1443729-1443751 CCCCATCGTGGACAGACATCATC No data
Right 1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG No data
1185619306_1185619314 26 Left 1185619306 X:1443703-1443725 CCATCTTGGCCATCGTGGACACA No data
Right 1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619314 Original CRISPR GTGGACACACACTGCCATCT TGG Intronic