ID: 1185619314

View in Genome Browser
Species Human (GRCh38)
Location X:1443752-1443774
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 4, 1: 7, 2: 29, 3: 35, 4: 331}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619310_1185619314 0 Left 1185619310 X:1443729-1443751 CCCCATCGTGGACAGACATCATC 0: 1
1: 1
2: 2
3: 6
4: 105
Right 1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG 0: 4
1: 7
2: 29
3: 35
4: 331
1185619311_1185619314 -1 Left 1185619311 X:1443730-1443752 CCCATCGTGGACAGACATCATCG 0: 1
1: 1
2: 0
3: 2
4: 25
Right 1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG 0: 4
1: 7
2: 29
3: 35
4: 331
1185619312_1185619314 -2 Left 1185619312 X:1443731-1443753 CCATCGTGGACAGACATCATCGT 0: 1
1: 1
2: 0
3: 5
4: 83
Right 1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG 0: 4
1: 7
2: 29
3: 35
4: 331
1185619306_1185619314 26 Left 1185619306 X:1443703-1443725 CCATCTTGGCCATCGTGGACACA 0: 2
1: 1
2: 1
3: 12
4: 309
Right 1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG 0: 4
1: 7
2: 29
3: 35
4: 331
1185619309_1185619314 1 Left 1185619309 X:1443728-1443750 CCCCCATCGTGGACAGACATCAT 0: 1
1: 1
2: 1
3: 21
4: 77
Right 1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG 0: 4
1: 7
2: 29
3: 35
4: 331
1185619307_1185619314 17 Left 1185619307 X:1443712-1443734 CCATCGTGGACACACACCCCCAT 0: 2
1: 3
2: 34
3: 48
4: 205
Right 1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG 0: 4
1: 7
2: 29
3: 35
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900035283 1:402652-402674 ATGGCTCCACACTGCCATCTTGG + Intergenic
900056904 1:638405-638427 ATGGCTCCACACTGCCATCTTGG + Intergenic
900541961 1:3207389-3207411 GTGGAAACACTCTGGCCTCTGGG - Intronic
901638385 1:10680826-10680848 GGGGACACACACTGACTTCCCGG + Intronic
906059211 1:42937437-42937459 GAGACCACACACTGCCAGCTAGG + Intronic
906137567 1:43510266-43510288 TTGGACATCCTCTGCCATCTTGG + Intergenic
909266453 1:73564833-73564855 GTGGAAACTCACTGCCAGTTGGG + Intergenic
910057035 1:83045591-83045613 ATGGAAACACAATGGCATCTAGG + Intergenic
913659851 1:120997219-120997241 GATGCCACACACTGCCATTTTGG - Intergenic
914011209 1:143780357-143780379 GATGCCACACACTGCCATTTTGG - Intergenic
914166625 1:145180779-145180801 GATGCCACACACTGCCATTTTGG + Intergenic
914649832 1:149688996-149689018 GATGCCACACACTGCCATTTTGG - Intergenic
916801571 1:168221177-168221199 GTGAACACACAAAGCAATCTAGG + Intergenic
918436458 1:184518721-184518743 GTGTACTCTCACTGCCATTTAGG + Intronic
921196234 1:212760383-212760405 GTGCACACACTCAGCCATCAAGG + Intronic
922257813 1:223908212-223908234 ATGGCTCCACACTGCCATCTTGG + Intergenic
924339011 1:243010991-243011013 ATGGCTCCACACTGCCATCTTGG + Intergenic
1063377268 10:5561810-5561832 TTGGAGTCACTCTGCCATCTTGG - Intergenic
1063685486 10:8233442-8233464 CTGGGCACACATAGCCATCTAGG + Intergenic
1064397014 10:14990361-14990383 GTGTACACACACTTCGATATTGG - Intergenic
1064399759 10:15011844-15011866 GTGTACACACCCTGCGATATTGG - Intergenic
1064399928 10:15012828-15012850 GTGCACACACACTTCGATATTGG - Intergenic
1066157277 10:32691456-32691478 CTGGTCACACATTGCTATCTTGG + Intronic
1066261059 10:33730155-33730177 GTGGACAAGCACTGGTATCTTGG + Intergenic
1073510606 10:104040306-104040328 GAGGACACATACTGGCTTCTGGG + Intronic
1073762471 10:106645051-106645073 GTAGATACATACTGCCATTTGGG - Intronic
1074353641 10:112762139-112762161 GTGGCCAAACACTGGCATCGCGG + Intronic
1075698421 10:124452268-124452290 GAGGCCACATACTTCCATCTGGG - Intergenic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1076423615 10:130351709-130351731 GTGCACACATTCTGCCAGCTGGG + Intergenic
1076808240 10:132870422-132870444 GTGGAGACAGACTGCAAGCTCGG + Intronic
1078832529 11:14991391-14991413 GTGGACACACTTTGCGATATGGG - Intronic
1078832660 11:14992155-14992177 ATGTACACCCACTGCCATATTGG - Intronic
1079038833 11:17043401-17043423 GTGTACACACCCTGCGATATTGG + Intergenic
1081448960 11:43154760-43154782 GTGTACACCCACTGCTATATTGG - Intergenic
1081449030 11:43155279-43155301 GTGTACACTCACTGCGATATTGG - Intergenic
1081449226 11:43156450-43156472 GTGTACACCCACTGCTATATTGG - Intergenic
1081449438 11:43157790-43157812 GTGTACACCCACTGCTATATTGG + Intergenic
1081450930 11:43170191-43170213 GTGTACACCCTCTGCCATATAGG + Intergenic
1081990670 11:47335865-47335887 GGGGACACTCACAGCCCTCTGGG + Exonic
1082168352 11:48971514-48971536 GTGGACACCCCCTGCGATATGGG + Intergenic
1082235090 11:49814435-49814457 GTGGACACCCCCTGCGATATGGG - Intergenic
1082608788 11:55275407-55275429 GTGGACACCCCCTGCGATATGGG - Intergenic
1082936803 11:58664082-58664104 GTGTACACACCCTGCGATATTGG + Intronic
1084227497 11:67726341-67726363 GTGTACACACACTTCGATATTGG - Intergenic
1084260752 11:67977131-67977153 GTGTACACACCCTGCGATATTGG - Intergenic
1084260917 11:67978038-67978060 GTGTACACACACTTCGATATTGG - Intergenic
1084261663 11:67983065-67983087 ATGCACACCCACTGCTATCTTGG - Intergenic
1084807706 11:71590524-71590546 GTGTACACACACTTCGATATTGG + Intronic
1084810981 11:71611046-71611068 ATGCACACCCACTGCTATCTTGG + Intergenic
1084811728 11:71616080-71616102 GTGTACACACACTTCGATATTGG + Intergenic
1085515106 11:77107124-77107146 GTGGGCACCCCCTGCCTTCTTGG - Intronic
1086701818 11:89907106-89907128 GTGGACACACCCTGCGATATGGG + Intergenic
1086704350 11:89937419-89937441 GTGGACACACCCTGCGATATGGG - Intergenic
1091585935 12:1816677-1816699 GTGCACACAGACTGTCACCTCGG + Intronic
1092432174 12:8418588-8418610 GTGTACACACACTTCGATATTGG - Intergenic
1092435137 12:8441453-8441475 GTGTACACACCCTTCCATATTGG - Intergenic
1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG + Intronic
1095697167 12:45155768-45155790 GTGTACACCCACTGCGATATTGG - Intergenic
1095697175 12:45155844-45155866 GTGTACACCCACTGCGATTTGGG - Intergenic
1095697290 12:45156581-45156603 GTGTACACTCACTGCAATATAGG - Intergenic
1096506704 12:52098291-52098313 GTGTACACACACTTCGATATTGG + Intergenic
1096508816 12:52115544-52115566 GTGTACACACACTTCGATATTGG - Intergenic
1097432883 12:59530353-59530375 GCGGACACACACTGCGATTTGGG - Intergenic
1097434217 12:59540171-59540193 GTGTACACCCACTGCGATATTGG - Intergenic
1098154691 12:67585506-67585528 GTGGACACAGAGTCCAATCTAGG + Intergenic
1099086383 12:78251683-78251705 CTGGAGCCACACTGCCAGCTTGG + Intergenic
1099181275 12:79474462-79474484 GTGTACACACCCTGCGATATTGG - Intergenic
1099181684 12:79476955-79476977 GTGTACACACCCTGCGATATTGG - Intergenic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1101745358 12:107537641-107537663 GTTGACACTCACTGTCCTCTGGG - Intronic
1102692250 12:114770519-114770541 GTGCATACCCACTGCCATCTGGG + Intergenic
1103504212 12:121430330-121430352 CTGGACACTCACAGACATCTCGG + Exonic
1104808559 12:131605415-131605437 GAGGTCACTCATTGCCATCTTGG + Intergenic
1108169318 13:47724916-47724938 GTTCAGACACACTGCCAACTAGG - Intergenic
1111605817 13:90538088-90538110 GGAGACCCACGCTGCCATCTGGG - Intergenic
1112216644 13:97437325-97437347 GTGGCCACAGGCTGCCATATTGG + Intronic
1113843468 13:113373150-113373172 GTGGACATACACTGCCTCCTAGG + Intergenic
1114436898 14:22714120-22714142 GTGTACACTCACTGCAATTTTGG - Intergenic
1116082195 14:40188200-40188222 GTGGACAGCAACTGCCATGTTGG - Intergenic
1116114364 14:40629241-40629263 GTGTACCCACACTGCCAGCGTGG + Intergenic
1116517633 14:45819801-45819823 GTGTACACCCCCTGCCATATAGG + Intergenic
1117039181 14:51753990-51754012 GTGCACACACCCTGCGATATTGG + Intergenic
1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG + Intergenic
1120132416 14:80823064-80823086 GTTGACACACATGGCCACCTTGG + Intronic
1121278711 14:92685312-92685334 CTGGACACACACTGGCAGCAGGG - Intronic
1121715570 14:96071571-96071593 GTGAACACACACTGCCCCCTGGG + Intronic
1121735243 14:96213800-96213822 GTGGAGACACAATGCCTACTTGG - Intronic
1121926874 14:97935044-97935066 GTGGTCACCTACTGCCATATGGG + Intronic
1122319725 14:100846677-100846699 GTGTACACACACTCTCATCCTGG - Intergenic
1202828698 14_GL000009v2_random:3610-3632 GTGTACACCCCCTGCCATATTGG + Intergenic
1124553996 15:30708918-30708940 GTGGGCACCCACCCCCATCTGGG + Intronic
1124677251 15:31696753-31696775 GTGGGCACCCACCCCCATCTGGG - Intronic
1125488175 15:40126812-40126834 GTGCACACCCTCTGCCATATTGG - Intergenic
1125488244 15:40127264-40127286 GTGTACACAGACTGCGATATTGG - Intergenic
1125489106 15:40133427-40133449 GTGTACACCCACTGCTATATTGG - Intergenic
1129900663 15:79145945-79145967 GTGCACACACACTGCTTTCCTGG - Intergenic
1130188840 15:81712336-81712358 GTGTACACACCCTGCGATATTGG - Intergenic
1131076512 15:89498711-89498733 GTGGCCACACTGTGCCAGCTTGG + Intergenic
1131081523 15:89540369-89540391 GGGGACACACAGTGGCTTCTAGG + Intergenic
1132243052 15:100275716-100275738 GTGGAAGCACTTTGCCATCTGGG + Intronic
1133991684 16:10712114-10712136 GTGTACACTCCCTGCCATATTGG + Intergenic
1135907880 16:26530060-26530082 GTGCACTCCCAATGCCATCTTGG + Intergenic
1135931676 16:26743386-26743408 GAGGACAAACACTACCATGTGGG - Intergenic
1138128750 16:54460515-54460537 GTGGACAGACAGAGCCAGCTAGG + Intergenic
1139298644 16:65925152-65925174 ATGGACACATACTGCAATTTGGG + Intergenic
1139597952 16:67968884-67968906 GGGGAAACACACTTCCACCTCGG + Intronic
1144495240 17:15741601-15741623 ATGGGCAGACACTTCCATCTTGG - Intronic
1144638992 17:16927296-16927318 ATGGGCAGACATTGCCATCTTGG + Intergenic
1145007543 17:19346080-19346102 GGGGACCCACACAGCCATCCAGG - Intronic
1146277385 17:31524259-31524281 GTGGATCCCCACTCCCATCTTGG - Intronic
1148107461 17:45127060-45127082 GTGGCCACACACAGCCCTTTGGG - Intronic
1148760568 17:49997746-49997768 ATGGACCCACTCTGGCATCTTGG - Intergenic
1150884082 17:69065159-69065181 GTGAACACAAAGTGCCATGTAGG - Intergenic
1155542592 18:26884051-26884073 GTGGACACCCCCCGCCATATGGG - Intergenic
1155542633 18:26884207-26884229 GTGGACACCCCCTGCGATATGGG - Intergenic
1155824183 18:30418383-30418405 TTTGAGACACACTGCCATTTGGG + Intergenic
1156009186 18:32476265-32476287 GTTGACACACATAGCCACCTTGG - Intergenic
1158106131 18:53887083-53887105 GTGGACTCACACACCCATATGGG - Intergenic
1159946622 18:74448612-74448634 GTGCACACACACTTCCCTCTTGG - Intronic
1160537792 18:79604199-79604221 GTGGCCTCACGCTGCCCTCTGGG - Intergenic
1161490649 19:4559430-4559452 GTGGAGACACTCTCCCATCCAGG + Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1162094757 19:8303793-8303815 GGGGACACCCACTGCCTGCTGGG - Intronic
1166236475 19:41460664-41460686 GTGTACACACTCTGCGATATCGG + Intergenic
1166237565 19:41467590-41467612 GTGTACACCCACTGCGATATCGG + Intergenic
1166237731 19:41468729-41468751 GTGCACACACCCTGCGATATTGG + Intergenic
1166242322 19:41502861-41502883 GTGTACACCCACTGCGATATGGG + Intergenic
1166244826 19:41517928-41517950 GTGGACACACCCTGCGATATTGG + Intergenic
1166244992 19:41518976-41518998 GTGTACACCCCCTGCCATATTGG + Intergenic
1166245532 19:41522950-41522972 GTGTACACACCCTGCGATATTGG + Intergenic
1166245698 19:41524051-41524073 GTGTACACCCACTGCGATATTGG + Intergenic
1168506564 19:56940046-56940068 GAGGACAGACAATGTCATCTGGG + Intergenic
1202644002 1_KI270706v1_random:124198-124220 GTGTACACCCCCTGCCATATTGG - Intergenic
1202644974 1_KI270706v1_random:131273-131295 GTGTACACCCACTGCGATATTGG - Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
929568885 2:43007218-43007240 GAGGACCCACACTGCTTTCTAGG + Intergenic
934506291 2:94897357-94897379 GAGTACACACACTGCGATTTTGG - Intergenic
936024602 2:109021694-109021716 ATGGACACACACTGCCTGCGAGG - Intergenic
937922049 2:127137714-127137736 CTTGTCACACCCTGCCATCTAGG - Intergenic
938022962 2:127921179-127921201 GGGGTCTCACTCTGCCATCTAGG + Intergenic
940018967 2:149136473-149136495 CTGGTGACCCACTGCCATCTGGG - Intronic
940874602 2:158886686-158886708 GTGTACACACACTTCGATATTGG + Intergenic
941533466 2:166695999-166696021 GTGTACACACCCTGCGATGTTGG - Intergenic
942317272 2:174707760-174707782 GTGTACACCCCCTGCCATATTGG + Intergenic
943713699 2:191126616-191126638 CTGGCCACAGACTGCCCTCTGGG + Intronic
944876605 2:203968854-203968876 GGGGAGACACAGTGCCACCTGGG - Intergenic
945230843 2:207587831-207587853 ATGGACACAAACTTACATCTAGG + Intronic
945561469 2:211345950-211345972 GTCCACACAGACTGCCATCATGG + Intergenic
947434239 2:230059182-230059204 GAGGACACCCAGGGCCATCTGGG + Exonic
1169074739 20:2753687-2753709 GTGGACAGACAGTGCAGTCTCGG - Intronic
1171893966 20:30743144-30743166 GTGTACACCCCCTGCCATGTTGG - Intergenic
1171894936 20:30750194-30750216 GTGTACACCCACTGCGATATTGG - Intergenic
1174165943 20:48583698-48583720 GTGTACAAAAACTGCCAGCTGGG + Intergenic
1176173019 20:63704685-63704707 GTGGACCCACACTTCCACGTTGG - Intronic
1176607880 21:8848438-8848460 GTGTACACCCCCTGCCATATTGG + Intergenic
1178443047 21:32613823-32613845 GTGTACACACCCTGCGATATTGG + Intergenic
1179671722 21:42954127-42954149 GTGTACACACCCTGCGATATTGG - Intergenic
1179671866 21:42954953-42954975 GTGTACACACACTTCGATATTGG - Intergenic
1180356985 22:11851171-11851193 GTGTACACCCACTGCGATATTGG + Intergenic
1180357964 22:11858238-11858260 GTGTACACCCCCTGCCATATTGG + Intergenic
1180380304 22:12134095-12134117 GTGTACACCCCCTGCCATATTGG - Intergenic
1180381277 22:12141160-12141182 GTGTACACCCACTGCGATATTGG - Intergenic
1181788170 22:25242684-25242706 TTGGACAGAAACTGCTATCTCGG - Intergenic
1182741333 22:32570153-32570175 CTCCACACACACTGCCTTCTAGG + Intronic
1183116382 22:35695539-35695561 GTGTACACCCACTGCGATATTGG + Intergenic
1184202217 22:42978532-42978554 GAGGAGAAACACTGTCATCTGGG - Intronic
1185240909 22:49746024-49746046 GTGGATTCACATTTCCATCTGGG + Intergenic
949880106 3:8654853-8654875 GAGGCCACACACTGAGATCTGGG - Intronic
949882505 3:8672820-8672842 ATGCACACCCACTGCTATCTTGG + Intronic
950073969 3:10174077-10174099 ATCCACACACACTCCCATCTTGG - Intronic
953387733 3:42516198-42516220 GTGGGCACACACAGCCAGCCTGG + Intronic
954647597 3:52141004-52141026 GATGACACATACTGCCACCTGGG + Intronic
957044188 3:75361409-75361431 GTGTACACACACTTCGATATTGG - Intergenic
957076735 3:75608645-75608667 ATGCACACCCACTGCTATCTTGG - Intergenic
961275314 3:125721594-125721616 GTGTACACACACTTCGATATTGG + Intergenic
961278227 3:125744215-125744237 GTGTACACACACTTCGATATTGG + Intergenic
961876179 3:130025440-130025462 GTGTACACACACTTCGATATTGG - Intergenic
963259055 3:143176058-143176080 GTGGACACACACTCCCGCTTGGG + Intergenic
964888884 3:161515404-161515426 GTGTACACACCCTGCGATATTGG + Intergenic
965779697 3:172271866-172271888 AAGGATAGACACTGCCATCTTGG + Intronic
968067889 3:195768936-195768958 CTGCACACACACTCCCATCCTGG - Intronic
968601999 4:1513828-1513850 GTGGCCATACTCTTCCATCTTGG + Intergenic
969020188 4:4134940-4134962 ATGCACACCCACTGCTATCTTGG - Intergenic
969024142 4:4160285-4160307 GTGTACACACACTTCGATATTGG - Intergenic
969590304 4:8118229-8118251 TTGCACACTGACTGCCATCTGGG + Intronic
969729678 4:8946854-8946876 GTGTACACACACTTCGATATTGG + Intergenic
969734420 4:8977532-8977554 GTGAACACACACTTCGATATTGG + Intergenic
969785842 4:9456405-9456427 GTGTACACACACTTCGATATTGG + Intergenic
969789264 4:9480810-9480832 GTGTACACACACTTCAATATTGG + Intergenic
969789409 4:9481646-9481668 GTGTACACACCCTGCGATATTGG + Intergenic
973966259 4:56165028-56165050 ATGGCCAGAAACTGCCATCTGGG - Intergenic
976504616 4:85832372-85832394 GTGAAAACACACTGCCAGGTGGG + Intronic
976732507 4:88278409-88278431 CTGGACTCCCACTACCATCTGGG + Exonic
978292004 4:107152731-107152753 GTGTACACACACAGCCAAATAGG + Intronic
978482151 4:109205427-109205449 GTGGACAGACATTGACATATAGG + Intronic
979238110 4:118424247-118424269 ATGGCTCCACACTGCCATCTTGG - Intergenic
982448220 4:155519995-155520017 TTGCACAAACAGTGCCATCTAGG - Intergenic
983623333 4:169782601-169782623 GTGTACACACAATGCGATATGGG - Intergenic
983623535 4:169783707-169783729 GTGTACACCCACTGCGATATGGG - Intergenic
983623926 4:169786099-169786121 GTGTACACACCCTGCGATATTGG + Intergenic
983624233 4:169787822-169787844 GTGTACACCCACTGCGATATTGG + Intergenic
985222157 4:187718472-187718494 GATGACACAAAATGCCATCTAGG - Intergenic
986353441 5:6902225-6902247 GTGGACACAGATTGTCACCTGGG + Intergenic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
994391326 5:99196391-99196413 GTGTACACACCCTGCGATATTGG + Intergenic
994391478 5:99197429-99197451 GTGGACACCCTCTGCCATATTGG + Intergenic
994393340 5:99209363-99209385 GTGGACACCCACTGTGATATTGG + Intergenic
994396347 5:99228541-99228563 GTGTACACCCACTGCAATATTGG + Intergenic
994396359 5:99228617-99228639 GTGTACACACCCTGCGATATTGG + Intergenic
995067594 5:107879844-107879866 GTGGCCACAGACTGCCCCCTGGG + Intronic
995710610 5:115031720-115031742 CAGGGCACTCACTGCCATCTGGG + Intergenic
996013921 5:118509989-118510011 GTGGTCACATACTGACCTCTGGG - Intergenic
997682324 5:135765239-135765261 GTGTACACACCCTGCGATGTGGG - Intergenic
997682836 5:135768150-135768172 GTGTACACCCACTGCGATATTGG + Intergenic
997687266 5:135797184-135797206 GTGTACACCCACTGCGATATTGG - Intergenic
997687830 5:135800991-135801013 GTGTACACACCCTGCGATATTGG - Intergenic
997687973 5:135801949-135801971 GTGTACACCCACTGCAATATTGG - Intergenic
998822151 5:146066892-146066914 GTGGTCAGACTCTGGCATCTTGG + Intronic
1002261161 5:177994971-177994993 CTGGACACACACGACCACCTGGG + Intronic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1002738536 5:181416219-181416241 ATGGCTCCACACTGCCATCTTGG - Intergenic
1004561398 6:16755049-16755071 GTGCACACACATTGTCATATAGG - Intronic
1007092569 6:39193388-39193410 GTGGCCTCCCACTGCCCTCTGGG + Intronic
1007200344 6:40102770-40102792 GTGAACACACAGGGCCTTCTAGG + Intergenic
1007407469 6:41643291-41643313 CTTGACACACTCAGCCATCTGGG + Intronic
1007697736 6:43744396-43744418 GTGCACACACACAGCCAACTGGG - Intergenic
1007915914 6:45561527-45561549 GTGGACACGTACTGCCAGCATGG + Intronic
1009046844 6:58244368-58244390 GTGGACACCCTCTGCGATATTGG - Intergenic
1009047192 6:58246565-58246587 GTGTACACACCCTTCCATATTGG - Intergenic
1009048021 6:58251010-58251032 GTGTACACACCCTGCGATATAGG - Intergenic
1009222656 6:60998672-60998694 GTGGACACCCTCTGCGATATTGG - Intergenic
1009223001 6:61000862-61000884 GTGTACACACCCTTCCATATTGG - Intergenic
1009225267 6:61015365-61015387 GTGTACACCCCCTGCCATATTGG + Intergenic
1009362991 6:62837238-62837260 GTGTACACACCCTGCGATATTGG - Intergenic
1009363330 6:62839497-62839519 GTGGACACTCCCTGCGATATTGG - Intergenic
1009363880 6:62843266-62843288 GTGGACACCCCCTGCGATATTGG - Intergenic
1009364374 6:62846626-62846648 GTGTACACCCACTGCGATATTGG + Intergenic
1009364451 6:62847221-62847243 GTGTACACACCCTGCGATATTGG + Intergenic
1009364735 6:62849207-62849229 GTGTACACCCACTGCAATATTGG - Intergenic
1009366367 6:62860814-62860836 GTGGACACTCCCCGCCATATGGG - Intergenic
1009366415 6:62860974-62860996 GTGGACACCCCCCGCCATATGGG - Intergenic
1009366438 6:62861055-62861077 GTGGACACCCCCCGCCATATGGG - Intergenic
1009366518 6:62861360-62861382 GTGGACACCCCCAGCCATATGGG - Intergenic
1009367522 6:62867249-62867271 GTGCACACCCACTGCGATTTTGG + Intergenic
1009369159 6:62879582-62879604 GTGTACACACTCTGCGATATTGG - Intergenic
1009460487 6:63907027-63907049 GTGTACACACTATGCAATCTTGG - Intronic
1010625296 6:78131248-78131270 ATGGAAACACACTGCCATGAAGG + Intergenic
1011274080 6:85611651-85611673 CTGGACACTCACTGTCATCAAGG + Intronic
1012774992 6:103486622-103486644 GTGTACACACCCTGCGATATTGG - Intergenic
1012914587 6:105155890-105155912 TTGGCCACACATTGCCATCATGG - Intergenic
1015217156 6:130763299-130763321 GTGAAAACACACTGCCTTCCTGG + Intergenic
1015711469 6:136146083-136146105 TTGGTCACTCACTGCCATCAGGG + Intronic
1019243639 6:170691771-170691793 ATGGCTCCACACTGCCATCTTGG - Intergenic
1020306639 7:6840924-6840946 GTGTACACACCCTGCGATATTGG - Intergenic
1020307601 7:6846969-6846991 ATGCACACCCACTGCTATCTTGG - Intergenic
1020335193 7:7057513-7057535 GAGTACACACCCTGCCATATGGG - Intergenic
1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG + Intergenic
1020336033 7:7063053-7063075 GTGTACACCCACTGCGATATTGG - Intergenic
1020336214 7:7064256-7064278 GTGTACACCCACTGCGATATTGG - Intergenic
1020650929 7:10875262-10875284 CTGGACAGACACTGGCAGCTAGG - Intergenic
1023208814 7:37781452-37781474 GTGGACATTCACTGATATCTGGG + Intronic
1023266364 7:38410366-38410388 CAGGCCCCACACTGCCATCTGGG - Intronic
1028293313 7:89095261-89095283 GCGGTCACAAAATGCCATCTTGG + Intronic
1029077981 7:97950850-97950872 GTGTACACACACTTCGATATTGG - Intergenic
1029078719 7:97955913-97955935 ATGCACACCCACTGCTATCTTGG - Intergenic
1029301425 7:99584757-99584779 GTGGACACCCCCTGCGATATTGG + Intronic
1029342866 7:99958879-99958901 GTGTACACCCTCTGCCATATGGG - Intergenic
1032797296 7:135288291-135288313 GTGGACACTCAGTGCCAGCCAGG - Intergenic
1035370260 7:158375431-158375453 GTGGCCAAACCCAGCCATCTCGG + Intronic
1035504483 8:116389-116411 ATGGCTCCACACTGCCATCTTGG + Intergenic
1036240023 8:7073659-7073681 GTGTACACACACTTCGATATTGG + Intergenic
1036240337 8:7075407-7075429 GTGTACACACCCTGCGATATTGG + Intergenic
1036819977 8:11932578-11932600 GTGTACACACACTTCGATATTGG - Intergenic
1036903299 8:12687922-12687944 GTGTACACACACTTCGATATTGG - Intergenic
1036905799 8:12707588-12707610 GTGTACACACACTTCGATGTTGG - Intergenic
1037369832 8:18163788-18163810 GTGGACATACACTGATGTCTGGG - Intergenic
1038433978 8:27521818-27521840 GTGGATAGGCTCTGCCATCTAGG + Intronic
1038574760 8:28695441-28695463 GTGGACACCCAGTGTCACCTGGG + Intronic
1038637829 8:29301701-29301723 GTGTACACACCCTGCGATATTGG + Intergenic
1038639781 8:29314510-29314532 GTGTACACCCACTGTCATTTAGG - Intergenic
1043252926 8:78098456-78098478 TTGGACCCTCACTGACATCTAGG + Intergenic
1043634246 8:82369752-82369774 GTGTACACTCACTGCGATATTGG + Intergenic
1043634588 8:82372065-82372087 GTGAACACACCCTGCGATATTGG + Intergenic
1043635099 8:82375272-82375294 GTGTACACCCCCTGCCATATTGG - Intergenic
1043635739 8:82379045-82379067 GTGTACACACCCTGCGATATTGG - Intergenic
1043669585 8:82865370-82865392 GTGGACAACCACTTCCAGCTGGG - Intergenic
1044824658 8:96184534-96184556 TTGGACACACACTGAGTTCTAGG - Intergenic
1045337497 8:101221753-101221775 GTACACACACACACCCATCTTGG - Intergenic
1045924168 8:107567271-107567293 GTGTACACACCCTGCAATATGGG - Intergenic
1045924931 8:107572294-107572316 GTGTACACACCCTGCGATATTGG - Intergenic
1045925778 8:107577799-107577821 GTGGACACCCCCTGCGATATTGG - Intergenic
1045926320 8:107581623-107581645 GTGTACACACCCTGCGATATTGG - Intergenic
1045927714 8:107590935-107590957 GTGTACACACCCTGCAATATGGG - Intergenic
1049054225 8:140222276-140222298 GGAGCCACACTCTGCCATCTGGG + Intronic
1050902304 9:10963792-10963814 ATGTACACCCCCTGCCATCTTGG + Intergenic
1054353714 9:64042575-64042597 GTGTACACTCACTGCGATATTGG + Intergenic
1054354669 9:64049552-64049574 GTGTACACCCCCTGCCATATTGG + Intergenic
1054813304 9:69451814-69451836 TTGTACAAACACTGCAATCTAGG - Intronic
1056866047 9:90228152-90228174 GTGTACACACACTTCGATATTGG + Intergenic
1056916978 9:90754754-90754776 GTGTACACACACTTCGATATTGG - Intergenic
1056969098 9:91187728-91187750 GTGGACACACCCTGCCCACCAGG + Intergenic
1057287762 9:93774223-93774245 CAGCACAGACACTGCCATCTTGG + Intergenic
1057308150 9:93924524-93924546 GAGGACAAACCCTGCCATCCCGG + Intergenic
1058518696 9:105799275-105799297 GTGTACACACCCTGCGATATTGG + Intergenic
1058519090 9:105801739-105801761 GTGTACACACACTGCGATATTGG + Intergenic
1058520205 9:105808881-105808903 GTGTACACACCCTGCGATATGGG - Intergenic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG + Intergenic
1203695621 Un_GL000214v1:94631-94653 GTGTACACCCACTGCGATATTGG - Intergenic
1203742043 Un_GL000218v1:11684-11706 GTGTACACCCACTGCGATATTGG + Intergenic
1203743008 Un_GL000218v1:18676-18698 GTGTACACCCCCTGCCATATTGG + Intergenic
1203702241 Un_KI270742v1:6274-6296 GTGTACACCCACTGCGATATTGG + Intergenic
1203703222 Un_KI270742v1:13334-13356 GTGTACACCCCCTGCCATATTGG + Intergenic
1203603828 Un_KI270748v1:40994-41016 ATGGCTCCACACTGCCATCTTGG - Intergenic
1203640652 Un_KI270751v1:9432-9454 GTGTACACCCACTGCGATATTGG + Intergenic
1185550847 X:981379-981401 GTGTCCACACTCTGCCCTCTGGG + Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1185716621 X:2347907-2347929 GTGGACAATCACTGCTGTCTTGG + Intronic
1187580013 X:20597294-20597316 GTAGCCACACACTGAGATCTGGG - Intergenic
1189883585 X:45516512-45516534 GAGGAAACCCACTGCCATGTAGG + Intergenic
1190722071 X:53157473-53157495 CTTGACACACTCTGCAATCTTGG + Intergenic
1193873379 X:86829841-86829863 AGGGACACACACTGACATTTGGG - Intronic
1195117099 X:101710415-101710437 GAGGTCACTCATTGCCATCTTGG - Intergenic
1197739965 X:129883268-129883290 GTGGTCTCACTCTGTCATCTAGG + Intergenic
1198086218 X:133285203-133285225 GTGGACTTCCACTGCCATTTCGG - Intergenic
1201155574 Y:11129160-11129182 GTGTACACCCACTGCGATATTGG + Intergenic
1201156532 Y:11136145-11136167 GTGTACACCCCCTGCCATATTGG + Intergenic
1202385888 Y:24326039-24326061 ATGGCTCCACACTGCCATCTTGG - Intergenic
1202484898 Y:25344089-25344111 ATGGCTCCACACTGCCATCTTGG + Intergenic