ID: 1185619315

View in Genome Browser
Species Human (GRCh38)
Location X:1443761-1443783
Sequence CACTGCCATCTTGGCCATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619312_1185619315 7 Left 1185619312 X:1443731-1443753 CCATCGTGGACAGACATCATCGT No data
Right 1185619315 X:1443761-1443783 CACTGCCATCTTGGCCATCGTGG No data
1185619311_1185619315 8 Left 1185619311 X:1443730-1443752 CCCATCGTGGACAGACATCATCG No data
Right 1185619315 X:1443761-1443783 CACTGCCATCTTGGCCATCGTGG No data
1185619309_1185619315 10 Left 1185619309 X:1443728-1443750 CCCCCATCGTGGACAGACATCAT No data
Right 1185619315 X:1443761-1443783 CACTGCCATCTTGGCCATCGTGG No data
1185619307_1185619315 26 Left 1185619307 X:1443712-1443734 CCATCGTGGACACACACCCCCAT No data
Right 1185619315 X:1443761-1443783 CACTGCCATCTTGGCCATCGTGG No data
1185619310_1185619315 9 Left 1185619310 X:1443729-1443751 CCCCATCGTGGACAGACATCATC No data
Right 1185619315 X:1443761-1443783 CACTGCCATCTTGGCCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619315 Original CRISPR CACTGCCATCTTGGCCATCG TGG Intronic