ID: 1185619316

View in Genome Browser
Species Human (GRCh38)
Location X:1443766-1443788
Sequence TGTGTCCACGATGGCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619316_1185619323 7 Left 1185619316 X:1443766-1443788 CCATCTTGGCCATCGTGGACACA No data
Right 1185619323 X:1443796-1443818 ATCGTGGACAGACACCATCGTGG No data
1185619316_1185619318 -9 Left 1185619316 X:1443766-1443788 CCATCTTGGCCATCGTGGACACA No data
Right 1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG No data
1185619316_1185619325 26 Left 1185619316 X:1443766-1443788 CCATCTTGGCCATCGTGGACACA No data
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619316 Original CRISPR TGTGTCCACGATGGCCAAGA TGG (reversed) Intronic