ID: 1185619317

View in Genome Browser
Species Human (GRCh38)
Location X:1443775-1443797
Sequence ATGGGGGTGTGTGTCCACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619317_1185619326 26 Left 1185619317 X:1443775-1443797 CCATCGTGGACACACACCCCCAT No data
Right 1185619326 X:1443824-1443846 CACCGCCATTTTGGCCATCGAGG No data
1185619317_1185619323 -2 Left 1185619317 X:1443775-1443797 CCATCGTGGACACACACCCCCAT No data
Right 1185619323 X:1443796-1443818 ATCGTGGACAGACACCATCGTGG No data
1185619317_1185619325 17 Left 1185619317 X:1443775-1443797 CCATCGTGGACACACACCCCCAT No data
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619317 Original CRISPR ATGGGGGTGTGTGTCCACGA TGG (reversed) Intronic