ID: 1185619318

View in Genome Browser
Species Human (GRCh38)
Location X:1443780-1443802
Sequence GTGGACACACACCCCCATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619312_1185619318 26 Left 1185619312 X:1443731-1443753 CCATCGTGGACAGACATCATCGT No data
Right 1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG No data
1185619316_1185619318 -9 Left 1185619316 X:1443766-1443788 CCATCTTGGCCATCGTGGACACA No data
Right 1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG No data
1185619310_1185619318 28 Left 1185619310 X:1443729-1443751 CCCCATCGTGGACAGACATCATC No data
Right 1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG No data
1185619311_1185619318 27 Left 1185619311 X:1443730-1443752 CCCATCGTGGACAGACATCATCG No data
Right 1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG No data
1185619309_1185619318 29 Left 1185619309 X:1443728-1443750 CCCCCATCGTGGACAGACATCAT No data
Right 1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619318 Original CRISPR GTGGACACACACCCCCATCG TGG Intronic