ID: 1185619320

View in Genome Browser
Species Human (GRCh38)
Location X:1443792-1443814
Sequence GATGGTGTCTGTCCACGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619320_1185619330 28 Left 1185619320 X:1443792-1443814 CCCCATCGTGGACAGACACCATC No data
Right 1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG No data
1185619320_1185619326 9 Left 1185619320 X:1443792-1443814 CCCCATCGTGGACAGACACCATC No data
Right 1185619326 X:1443824-1443846 CACCGCCATTTTGGCCATCGAGG No data
1185619320_1185619325 0 Left 1185619320 X:1443792-1443814 CCCCATCGTGGACAGACACCATC No data
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619320 Original CRISPR GATGGTGTCTGTCCACGATG GGG (reversed) Intronic