ID: 1185619321

View in Genome Browser
Species Human (GRCh38)
Location X:1443793-1443815
Sequence CGATGGTGTCTGTCCACGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619321_1185619330 27 Left 1185619321 X:1443793-1443815 CCCATCGTGGACAGACACCATCG No data
Right 1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG No data
1185619321_1185619326 8 Left 1185619321 X:1443793-1443815 CCCATCGTGGACAGACACCATCG No data
Right 1185619326 X:1443824-1443846 CACCGCCATTTTGGCCATCGAGG No data
1185619321_1185619325 -1 Left 1185619321 X:1443793-1443815 CCCATCGTGGACAGACACCATCG No data
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619321 Original CRISPR CGATGGTGTCTGTCCACGAT GGG (reversed) Intronic