ID: 1185619322

View in Genome Browser
Species Human (GRCh38)
Location X:1443794-1443816
Sequence ACGATGGTGTCTGTCCACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619322_1185619330 26 Left 1185619322 X:1443794-1443816 CCATCGTGGACAGACACCATCGT No data
Right 1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG No data
1185619322_1185619325 -2 Left 1185619322 X:1443794-1443816 CCATCGTGGACAGACACCATCGT No data
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG No data
1185619322_1185619326 7 Left 1185619322 X:1443794-1443816 CCATCGTGGACAGACACCATCGT No data
Right 1185619326 X:1443824-1443846 CACCGCCATTTTGGCCATCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619322 Original CRISPR ACGATGGTGTCTGTCCACGA TGG (reversed) Intronic