ID: 1185619323

View in Genome Browser
Species Human (GRCh38)
Location X:1443796-1443818
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619317_1185619323 -2 Left 1185619317 X:1443775-1443797 CCATCGTGGACACACACCCCCAT No data
Right 1185619323 X:1443796-1443818 ATCGTGGACAGACACCATCGTGG No data
1185619316_1185619323 7 Left 1185619316 X:1443766-1443788 CCATCTTGGCCATCGTGGACACA No data
Right 1185619323 X:1443796-1443818 ATCGTGGACAGACACCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type