ID: 1185619325

View in Genome Browser
Species Human (GRCh38)
Location X:1443815-1443837
Sequence GTGGACACACACCGCCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 1, 2: 26, 3: 33, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619316_1185619325 26 Left 1185619316 X:1443766-1443788 CCATCTTGGCCATCGTGGACACA 0: 2
1: 1
2: 1
3: 12
4: 309
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG 0: 1
1: 1
2: 26
3: 33
4: 104
1185619317_1185619325 17 Left 1185619317 X:1443775-1443797 CCATCGTGGACACACACCCCCAT 0: 2
1: 3
2: 34
3: 48
4: 205
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG 0: 1
1: 1
2: 26
3: 33
4: 104
1185619322_1185619325 -2 Left 1185619322 X:1443794-1443816 CCATCGTGGACAGACACCATCGT 0: 1
1: 1
2: 2
3: 17
4: 88
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG 0: 1
1: 1
2: 26
3: 33
4: 104
1185619321_1185619325 -1 Left 1185619321 X:1443793-1443815 CCCATCGTGGACAGACACCATCG 0: 1
1: 1
2: 0
3: 1
4: 43
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG 0: 1
1: 1
2: 26
3: 33
4: 104
1185619319_1185619325 1 Left 1185619319 X:1443791-1443813 CCCCCATCGTGGACAGACACCAT 0: 1
1: 1
2: 14
3: 27
4: 122
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG 0: 1
1: 1
2: 26
3: 33
4: 104
1185619320_1185619325 0 Left 1185619320 X:1443792-1443814 CCCCATCGTGGACAGACACCATC 0: 1
1: 1
2: 1
3: 16
4: 133
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG 0: 1
1: 1
2: 26
3: 33
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619325 Original CRISPR GTGGACACACACCGCCATTT TGG Intronic
900367623 1:2317719-2317741 GTGGAAACACACCGGCTTTGGGG - Intergenic
903285025 1:22271412-22271434 GTGGACACCCAAAGCCCTTTAGG + Intergenic
909266453 1:73564833-73564855 GTGGAAACTCACTGCCAGTTGGG + Intergenic
909574157 1:77154587-77154609 GTAGACACACACAGACTTTTGGG + Exonic
913659851 1:120997219-120997241 GATGCCACACACTGCCATTTTGG - Intergenic
914011209 1:143780357-143780379 GATGCCACACACTGCCATTTTGG - Intergenic
914166625 1:145180779-145180801 GATGCCACACACTGCCATTTTGG + Intergenic
914649832 1:149688996-149689018 GATGCCACACACTGCCATTTTGG - Intergenic
918084958 1:181237473-181237495 GTGGACACTCTCAGCTATTTGGG + Intergenic
918436458 1:184518721-184518743 GTGTACTCTCACTGCCATTTAGG + Intronic
921031861 1:211341094-211341116 GGGCACACCCACCCCCATTTGGG + Intronic
922808623 1:228403500-228403522 GGGGACAGGGACCGCCATTTGGG - Intronic
923177905 1:231486012-231486034 GTGGAGACACACAGACATTCAGG + Intergenic
1065782586 10:29183771-29183793 CTGGACACACAACTCCTTTTAGG + Intergenic
1073762471 10:106645051-106645073 GTAGATACATACTGCCATTTGGG - Intronic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1084519828 11:69656358-69656380 GTGTACAGACACCCCCATTGTGG - Intronic
1086701818 11:89907106-89907128 GTGGACACACCCTGCGATATGGG + Intergenic
1086704350 11:89937419-89937441 GTGGACACACCCTGCGATATGGG - Intergenic
1089454592 11:118618614-118618636 GAGTACACACACAGACATTTTGG - Intronic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1095697175 12:45155844-45155866 GTGTACACCCACTGCGATTTGGG - Intergenic
1097432883 12:59530353-59530375 GCGGACACACACTGCGATTTGGG - Intergenic
1105250067 13:18690654-18690676 GTGGCTTCCCACCGCCATTTAGG - Intergenic
1105449714 13:20488548-20488570 GAGAACACACACAGCCTTTTCGG + Intronic
1107999095 13:45890151-45890173 CTGGACACACTCAGCCCTTTTGG + Intergenic
1111810311 13:93090525-93090547 GTGGACACCCCCCGCGATATGGG + Intergenic
1114436898 14:22714120-22714142 GTGTACACTCACTGCAATTTTGG - Intergenic
1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG + Intergenic
1119812686 14:77536070-77536092 GTGGAGACACAACTCAATTTTGG + Intronic
1124553996 15:30708918-30708940 GTGGGCACCCACCCCCATCTGGG + Intronic
1124677251 15:31696753-31696775 GTGGGCACCCACCCCCATCTGGG - Intronic
1129468266 15:75736358-75736380 GTGGACTCACAGAGCCCTTTAGG + Intergenic
1139298644 16:65925152-65925174 ATGGACACATACTGCAATTTGGG + Intergenic
1141067818 16:80928127-80928149 GTGGATTCACACCGGCATGTGGG + Intergenic
1148046893 17:44749859-44749881 GGGGACAAACACAGTCATTTTGG - Intronic
1148107461 17:45127060-45127082 GTGGCCACACACAGCCCTTTGGG - Intronic
1155542592 18:26884051-26884073 GTGGACACCCCCCGCCATATGGG - Intergenic
1155542615 18:26884129-26884151 CTGGACACCCTCCGCCATATGGG - Intergenic
1155824183 18:30418383-30418405 TTTGAGACACACTGCCATTTGGG + Intergenic
1158106131 18:53887083-53887105 GTGGACTCACACACCCATATGGG - Intergenic
1160016436 18:75144390-75144412 ATGAACACACACCCCCATGTAGG - Intergenic
1162969488 19:14171657-14171679 GTGGACACATCCCACCCTTTGGG + Intronic
1166237034 19:41464211-41464233 GTGTACACACCCCGCGATATAGG + Intergenic
1166244676 19:41517024-41517046 GTGTACACACCCCGCGATATGGG + Intergenic
1166244826 19:41517928-41517950 GTGGACACACCCTGCGATATTGG + Intergenic
1166624965 19:44343401-44343423 GTGGCCACACACCGGCGTTAAGG + Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
926857198 2:17270077-17270099 GTGGTAACACACAGCCATTGAGG - Intergenic
931809965 2:65845308-65845330 CTGGACACACACCTCCTATTTGG + Intergenic
934506291 2:94897357-94897379 GAGTACACACACTGCGATTTTGG - Intergenic
935320002 2:101877439-101877461 GTGGACACAGACCTACATATTGG - Intronic
939003699 2:136763623-136763645 CTGCACACACACCCCCATATGGG - Intergenic
946948092 2:224843105-224843127 GTGGACACTCCCCGCAATATGGG - Intronic
947698801 2:232215643-232215665 GGTGACAAACACAGCCATTTGGG - Intronic
948316717 2:237032799-237032821 GTCTACACACACCACCATGTGGG + Intergenic
1178994593 21:37387076-37387098 TTGCACACCCACCTCCATTTAGG - Intronic
1184879429 22:47295597-47295619 GTGGCTACACACCTGCATTTTGG + Intergenic
951056046 3:18147493-18147515 GTGCACATACACAGTCATTTTGG - Intronic
963259055 3:143176058-143176080 GTGGACACACACTCCCGCTTGGG + Intergenic
965952461 3:174326873-174326895 GTGGGGACACATCACCATTTAGG + Intergenic
971144710 4:23963994-23964016 GTGAAGCCACACCACCATTTTGG + Intergenic
978292004 4:107152731-107152753 GTGTACACACACAGCCAAATAGG + Intronic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
994391478 5:99197429-99197451 GTGGACACCCTCTGCCATATTGG + Intergenic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1005706075 6:28454838-28454860 TTGGAGACACAGCACCATTTAGG + Intergenic
1007697736 6:43744396-43744418 GTGCACACACACAGCCAACTGGG - Intergenic
1009364110 6:62844840-62844862 GTGGACACCCCCCGCGATATTGG - Intergenic
1009366367 6:62860814-62860836 GTGGACACTCCCCGCCATATGGG - Intergenic
1009366415 6:62860974-62860996 GTGGACACCCCCCGCCATATGGG - Intergenic
1009366438 6:62861055-62861077 GTGGACACCCCCCGCCATATGGG - Intergenic
1009366518 6:62861360-62861382 GTGGACACCCCCAGCCATATGGG - Intergenic
1009366539 6:62861437-62861459 GTGGACACCCTTCCCCATTTGGG - Intergenic
1009367522 6:62867249-62867271 GTGCACACCCACTGCGATTTTGG + Intergenic
1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG + Intergenic
1024727102 7:52210702-52210724 GTGCACACACACACACATTTGGG - Intergenic
1038639781 8:29314510-29314532 GTGTACACCCACTGTCATTTAGG - Intergenic
1039641329 8:39226879-39226901 CTAGAGACACATCGCCATTTCGG - Intronic
1045926348 8:107581780-107581802 GAGGACACACTCCGCCACATCGG + Intergenic
1053431870 9:38047401-38047423 GTGTACACACACCTCCCCTTCGG + Intronic
1055522896 9:77099871-77099893 GTGGAGACAAACCTTCATTTTGG + Intergenic
1057247808 9:93472511-93472533 TTGGACACACAAGGCCAGTTTGG + Intronic
1058519090 9:105801739-105801761 GTGTACACACACTGCGATATTGG + Intergenic
1058870414 9:109196989-109197011 GTGTGCACACATCGCCCTTTTGG - Intronic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1062267046 9:135691690-135691712 GTGGACACACACCAACACATGGG + Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186758852 X:12702017-12702039 GTTGACTCTCAGCGCCATTTCGG + Intronic
1186938163 X:14474081-14474103 TTGTACACACACAGCCACTTAGG - Intergenic
1193873379 X:86829841-86829863 AGGGACACACACTGACATTTGGG - Intronic
1198086218 X:133285203-133285225 GTGGACTTCCACTGCCATTTCGG - Intergenic