ID: 1185619325

View in Genome Browser
Species Human (GRCh38)
Location X:1443815-1443837
Sequence GTGGACACACACCGCCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619316_1185619325 26 Left 1185619316 X:1443766-1443788 CCATCTTGGCCATCGTGGACACA No data
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG No data
1185619322_1185619325 -2 Left 1185619322 X:1443794-1443816 CCATCGTGGACAGACACCATCGT No data
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG No data
1185619319_1185619325 1 Left 1185619319 X:1443791-1443813 CCCCCATCGTGGACAGACACCAT No data
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG No data
1185619321_1185619325 -1 Left 1185619321 X:1443793-1443815 CCCATCGTGGACAGACACCATCG No data
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG No data
1185619320_1185619325 0 Left 1185619320 X:1443792-1443814 CCCCATCGTGGACAGACACCATC No data
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG No data
1185619317_1185619325 17 Left 1185619317 X:1443775-1443797 CCATCGTGGACACACACCCCCAT No data
Right 1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619325 Original CRISPR GTGGACACACACCGCCATTT TGG Intronic