ID: 1185619330

View in Genome Browser
Species Human (GRCh38)
Location X:1443843-1443865
Sequence GAGGACACACACCACCATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 934
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 904}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619320_1185619330 28 Left 1185619320 X:1443792-1443814 CCCCATCGTGGACAGACACCATC 0: 1
1: 1
2: 1
3: 16
4: 133
Right 1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG 0: 1
1: 0
2: 4
3: 25
4: 904
1185619319_1185619330 29 Left 1185619319 X:1443791-1443813 CCCCCATCGTGGACAGACACCAT 0: 1
1: 1
2: 14
3: 27
4: 122
Right 1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG 0: 1
1: 0
2: 4
3: 25
4: 904
1185619324_1185619330 10 Left 1185619324 X:1443810-1443832 CCATCGTGGACACACACCGCCAT 0: 2
1: 31
2: 28
3: 40
4: 152
Right 1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG 0: 1
1: 0
2: 4
3: 25
4: 904
1185619322_1185619330 26 Left 1185619322 X:1443794-1443816 CCATCGTGGACAGACACCATCGT 0: 1
1: 1
2: 2
3: 17
4: 88
Right 1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG 0: 1
1: 0
2: 4
3: 25
4: 904
1185619328_1185619330 -9 Left 1185619328 X:1443829-1443851 CCATTTTGGCCATCGAGGACACA 0: 1
1: 0
2: 2
3: 10
4: 81
Right 1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG 0: 1
1: 0
2: 4
3: 25
4: 904
1185619321_1185619330 27 Left 1185619321 X:1443793-1443815 CCCATCGTGGACAGACACCATCG 0: 1
1: 1
2: 0
3: 1
4: 43
Right 1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG 0: 1
1: 0
2: 4
3: 25
4: 904
1185619327_1185619330 -6 Left 1185619327 X:1443826-1443848 CCGCCATTTTGGCCATCGAGGAC 0: 1
1: 0
2: 1
3: 3
4: 55
Right 1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG 0: 1
1: 0
2: 4
3: 25
4: 904

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619330 Original CRISPR GAGGACACACACCACCATCG TGG Intronic
901069771 1:6511334-6511356 GAGGACAGGCACCACCAACAAGG + Intronic
903222452 1:21876333-21876355 AAGCACCCACACCACCAACGAGG - Exonic
906303907 1:44704100-44704122 GACCACACACCCCAGCATCGTGG + Exonic
910015906 1:82522922-82522944 AATGACACACACAACCATCAAGG - Intergenic
917855375 1:179095124-179095146 GGGGACATACACCATCATCTGGG - Exonic
919842175 1:201617582-201617604 AAGGACACACACCACCACACTGG - Intergenic
919938731 1:202271924-202271946 GAGGACAAACACCCCCTTAGAGG - Intronic
1064467317 10:15597234-15597256 AAGGTCACACACCACCATCCTGG + Exonic
1067718902 10:48711707-48711729 GAGGTGACACACCACCCTCATGG + Intronic
1070416135 10:76191304-76191326 GGGGACACTCAACACCATCCAGG - Intronic
1070829019 10:79407447-79407469 GAGCACGCACAGGACCATCGGGG + Intronic
1072736430 10:97882492-97882514 AAGGAGACACACCACCAACCTGG - Intronic
1076039035 10:127227283-127227305 GAGGACACCTACCACCATTAAGG + Intronic
1076817412 10:132921706-132921728 GAGGACACAGACCCCCAGAGGGG + Intronic
1081233614 11:40618246-40618268 GAGGACACACAACAGCACCCAGG + Intronic
1083548946 11:63571387-63571409 GAGGACAAACATCATCATAGTGG - Intergenic
1084418790 11:69049798-69049820 GCGGACGCACCCCACCCTCGGGG - Intronic
1084647265 11:70465729-70465751 GAGAAAACACATCATCATCGTGG + Intergenic
1087607586 11:100395118-100395140 GAGGACACACACCAGCAGTGAGG - Intergenic
1088726191 11:112637250-112637272 GGGCACACACAGCACCATGGTGG + Intergenic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1096351068 12:50901976-50901998 GAGGTCACGCCCCACCATAGAGG + Intergenic
1097179759 12:57165082-57165104 GAGGACACATACCAGCCTCCAGG + Intronic
1098379250 12:69851798-69851820 ACAGACACACACCACCATCTTGG + Intronic
1103600410 12:122051047-122051069 GGAGACACACACCCCCAACGTGG - Intronic
1106451210 13:29884237-29884259 TAGGACACACAGGACCATTGTGG + Intergenic
1113639055 13:111944286-111944308 GAGGACCCACACCCCCATGCAGG + Intergenic
1117112649 14:52475029-52475051 GAACACACACCCCACCACCGGGG + Intronic
1118493048 14:66280326-66280348 GAGAACACACACCAAAATCCAGG + Intergenic
1119875606 14:78056654-78056676 CAGGAAACTCACCACCATGGTGG - Intergenic
1122501122 14:102200342-102200364 GAGGACACGCTCCACGATCTGGG - Intronic
1123427382 15:20183701-20183723 GAGGCCACACAGCACAACCGGGG + Intergenic
1123503292 15:20911944-20911966 GAGGAAACAAACCACCATGAAGG - Intergenic
1123536618 15:21190251-21190273 GAGGCCACACAGCACAACCGGGG + Intergenic
1123560540 15:21485609-21485631 GAGGAAACAAACCACCATGAAGG - Intergenic
1123596778 15:21922905-21922927 GAGGAAACAAACCACCATGAAGG - Intergenic
1129472397 15:75762904-75762926 GAGGAGACGAACCACCATCCTGG + Intergenic
1130444571 15:83988501-83988523 GAGGAAACACTCCACCCTCCTGG + Intronic
1202968887 15_KI270727v1_random:212773-212795 GAGGAAACAAACCACCATGAAGG - Intergenic
1132511981 16:347592-347614 GAAGACGCCCACCACCTTCGGGG - Intronic
1133602034 16:7349094-7349116 GAGCAACCACACCTCCATCGTGG - Intronic
1135931676 16:26743386-26743408 GAGGACAAACACTACCATGTGGG - Intergenic
1137531801 16:49282552-49282574 GAGGCCAAGCTCCACCATCGCGG - Intergenic
1138537923 16:57669552-57669574 GAGCACCCACATCACCATGGGGG - Intronic
1138575507 16:57904826-57904848 GAAGACCCTCATCACCATCGGGG - Exonic
1141132650 16:81445871-81445893 GAGAACCCCCACCACCATCAGGG - Intronic
1142397848 16:89842820-89842842 GGGGACCCACACCCCCACCGTGG + Intronic
1144475903 17:15589074-15589096 CAGGACACTTACCAGCATCGAGG - Exonic
1144530799 17:16037166-16037188 CAGGACACACACCACCTTTATGG + Intronic
1151299859 17:73216225-73216247 GAGAACACGCACCACCCCCGAGG + Intronic
1152702349 17:81825350-81825372 GAGGACACACAACCCCAAGGTGG + Exonic
1156682978 18:39613491-39613513 GAGGACACACACACCCACCCGGG - Intergenic
1164443132 19:28294576-28294598 GAGGACACACACACCCAACCTGG + Intergenic
1165274111 19:34733499-34733521 GAGGACACAGACCCTCATCCTGG - Intergenic
1165443049 19:35841837-35841859 GAGCACACATACCACCAGGGTGG - Exonic
926426752 2:12745223-12745245 CAGGTCACACTCCACCATCTGGG - Intergenic
927689098 2:25194913-25194935 GGGGTCACACAGCAGCATCGTGG - Intergenic
927887068 2:26725147-26725169 GCAGACACATACCACCATCAGGG - Intronic
933944696 2:87275907-87275929 GAAGAAACACACCACCCTCTGGG - Intergenic
936335514 2:111585671-111585693 GAAGAAACACACCACCCTCTGGG + Intergenic
938246581 2:129781958-129781980 CAGGACACACATCCCCATGGAGG - Intergenic
948335148 2:237201699-237201721 GAGGACACGCACCACCAGTGAGG + Intergenic
1171422199 20:25024834-25024856 CAGCACACACAGCACCATCCGGG + Intronic
1176131246 20:63497730-63497752 GAAGACCCACATCAACATCGTGG - Exonic
1182347340 22:29675579-29675601 GAGGACACAGCCCACCCTGGAGG + Intronic
1184271573 22:43387454-43387476 GAGGACATCCAGCACCATGGAGG + Intergenic
1185260369 22:49858337-49858359 GAGGACATAAACTACCATCGGGG - Intronic
953469795 3:43156933-43156955 GAGGACACACCTTACCATAGTGG - Intergenic
963769001 3:149369622-149369644 GAGGAAACAAACCACCCTCTGGG - Exonic
965333101 3:167401652-167401674 GAGGTCACTCATCACCATCTTGG + Intergenic
966971128 3:185046454-185046476 CAGGCCACACTCCACCATCCAGG - Intronic
968957587 4:3727091-3727113 GGGGACACCCACCAGCATCCCGG - Intergenic
973205012 4:47550517-47550539 GAAGCCACACGCCACCATCTTGG - Intronic
994333657 5:98538406-98538428 GAGGACACACATCTCCAAAGAGG + Intergenic
998980806 5:147699948-147699970 TAGGTCACACACCACCATGAAGG - Intronic
999260946 5:150238715-150238737 GAGCACCAACACCACCATCGAGG - Exonic
1007071131 6:39039067-39039089 CAGGACACACATCACCATGGAGG + Intergenic
1015740266 6:136446389-136446411 GAAGGGACACACCACCATCCAGG + Intronic
1015828703 6:137344590-137344612 GAGAACAGACACCAACAGCGTGG + Intergenic
1019706168 7:2498212-2498234 GAGGAAACCCAACACCATGGGGG + Intergenic
1022823154 7:33981149-33981171 GAGGACTCCCACCAGCAACGTGG + Intronic
1035245148 7:157558388-157558410 GAGCACACACACCCACATGGGGG + Intronic
1036570480 8:9975898-9975920 GAGGACACAGCCCATCACCGAGG + Intergenic
1040142424 8:43938117-43938139 GAGAACACACATCACAATCAAGG - Intergenic
1040143992 8:43965824-43965846 GAGAACACACATCACAATCAAGG - Intergenic
1040144121 8:43967692-43967714 GAGAACACACATCACAATCAAGG - Intergenic
1040144249 8:43969564-43969586 GAGAACACACATCACAATCAAGG - Intergenic
1040144376 8:43971431-43971453 GAGAACACACATCACAATCCAGG - Intergenic
1040144504 8:43973300-43973322 GAGAACACACATCACAATCCAGG - Intergenic
1040144637 8:43975166-43975188 GAGAACACACATCACAATCCAGG - Intergenic
1040144768 8:43977034-43977056 GAGAACACACATCACAATCCAGG - Intergenic
1040144896 8:43978903-43978925 GAGAACACACATCACAATCCAGG - Intergenic
1040145032 8:43980770-43980792 GAGAACACACATCACAATCCAGG - Intergenic
1040145165 8:43982639-43982661 GAGAACACACATCACAATCCAGG - Intergenic
1040145267 8:44034100-44034122 GAGAACACACATCACAATCAAGG - Intergenic
1040145347 8:44035293-44035315 GAGAACACACATCACAATCCAGG - Intergenic
1040145519 8:44037843-44037865 GAGAACACACATCACAATCAAGG - Intergenic
1040145599 8:44039036-44039058 GAGAACACACATCACAATCAAGG - Intergenic
1040145749 8:44041421-44041443 GAGAACACACATCACAATCAAGG - Intergenic
1040145877 8:44043289-44043311 GAGAACACACATCACAATCAAGG - Intergenic
1040146005 8:44045159-44045181 GAGAACACACATCACAATCAAGG - Intergenic
1040146177 8:44047709-44047731 GAGAACACACATCACAATCAAGG - Intergenic
1040146348 8:44050259-44050281 GAGAACACACATCACAATCAAGG - Intergenic
1040146609 8:44054164-44054186 GAGAACACACATCACAATCAAGG - Intergenic
1040146687 8:44055357-44055379 GAGAACACACATCACAATCAAGG - Intergenic
1040146951 8:44059267-44059289 GAGAACACACATCACAATCAAGG - Intergenic
1040147078 8:44061134-44061156 GAGAACACACATCACAATCAAGG - Intergenic
1040147250 8:44063683-44063705 GAGAACACACATCACAATCAAGG - Intergenic
1040147423 8:44066232-44066254 GAGAACACACATCACAATCAAGG - Intergenic
1040147503 8:44067423-44067445 GAGAACACACATCACAATCAAGG - Intergenic
1040147762 8:44071328-44071350 GAGAACACACATCACAATCAAGG - Intergenic
1040148072 8:44075911-44075933 GAGAACACACATCACAATCAAGG - Intergenic
1040148204 8:44077779-44077801 GAGAACACACATCACAATCCAGG - Intergenic
1040148336 8:44079651-44079673 GAGAACACACATCACAATCCAGG - Intergenic
1040148464 8:44081520-44081542 GAGAACACACATCACAATCAAGG - Intergenic
1040148590 8:44083388-44083410 GAGAACACACATCACAATCAAGG - Intergenic
1040148854 8:44087295-44087317 GAGAACACACATCACAATCAAGG - Intergenic
1040148933 8:44088488-44088510 GAGAACACACATCACAATCAAGG - Intergenic
1040149013 8:44089681-44089703 GAGAACACACATCACAATCAAGG - Intergenic
1040149274 8:44093587-44093609 GAGAACACACATCACAATCAAGG - Intergenic
1040149586 8:44098168-44098190 GAGAACACACATCACAATCAAGG - Intergenic
1040149714 8:44100036-44100058 GAGAACACACATCACAATCAAGG - Intergenic
1040149887 8:44102585-44102607 GAGAACACACATCACAATCAAGG - Intergenic
1040149967 8:44103778-44103800 GAGAACACACATCACAATCAAGG - Intergenic
1040150047 8:44104971-44104993 GAGAACACACATCACAATCAAGG - Intergenic
1040150219 8:44107519-44107541 GAGAACACACATCACAATCAAGG - Intergenic
1040150298 8:44108712-44108734 GAGAACACACATCACAATCAAGG - Intergenic
1040150379 8:44109905-44109927 GAGAACACACATCACAATCAAGG - Intergenic
1040150550 8:44112455-44112477 GAGAACACACATCACAATCAAGG - Intergenic
1040150814 8:44116360-44116382 GAGAACACACATCACAATCAAGG - Intergenic
1040150939 8:44118229-44118251 GAGAACACACATCACAATCAAGG - Intergenic
1040151193 8:44121968-44121990 GAGAACACACATCACAATCAAGG - Intergenic
1040151363 8:44124518-44124540 GAGAACACACATCACAATCAAGG - Intergenic
1040151535 8:44127067-44127089 GAGAACACACATCACAATCAAGG - Intergenic
1040151704 8:44129616-44129638 GAGAACACACATCACAATCAAGG - Intergenic
1040151832 8:44131484-44131506 GAGAACACACATCACAATCAAGG - Intergenic
1040151911 8:44132677-44132699 GAGAACACACATCACAATCAAGG - Intergenic
1040152225 8:44137257-44137279 GAGAACACACATCACAATCAAGG - Intergenic
1040152354 8:44139128-44139150 GAGAACACACATCACAATCAAGG - Intergenic
1040152569 8:44142354-44142376 GAGAACACACATCACAATCAAGG - Intergenic
1040152694 8:44144223-44144245 GAGAACACACATCACAATCAAGG - Intergenic
1040152954 8:44148125-44148147 GAGAACACACATCACAATCAAGG - Intergenic
1040153035 8:44149318-44149340 GAGAACACACATCACAATCAAGG - Intergenic
1040153298 8:44153224-44153246 GAGAACACACATCACAATCAAGG - Intergenic
1040153558 8:44157127-44157149 GAGAACACACATCACAATCAAGG - Intergenic
1040153638 8:44158321-44158343 GAGAACACACATCACAATCAAGG - Intergenic
1040153810 8:44160872-44160894 GAGAACACACATCACAATCAAGG - Intergenic
1040153982 8:44163421-44163443 GAGAACACACATCACAATCAAGG - Intergenic
1040154477 8:44170714-44170736 GAGAACACACATCACAATCAAGG - Intergenic
1040154605 8:44172582-44172604 GAGAACACACATCACAATCAAGG - Intergenic
1040154686 8:44173775-44173797 GAGAACACACATCACAATCAAGG - Intergenic
1040154812 8:44175644-44175666 GAGAACACACATCACAATCAAGG - Intergenic
1040155077 8:44179548-44179570 GAGAACACACACCACAATCAAGG - Intergenic
1040155157 8:44180739-44180761 GAGAACACACATCACAATCAAGG - Intergenic
1040155513 8:44186004-44186026 GAGAACACACATCACAATCAAGG - Intergenic
1040155683 8:44188555-44188577 GAGAACACACATCACAATCAAGG - Intergenic
1040155807 8:44190423-44190445 GAGAACACACATCACAATCAAGG - Intergenic
1040156299 8:44197717-44197739 GAGAACACACATCACAATCAAGG - Intergenic
1040156379 8:44198910-44198932 GAGAACACACATCACAATCAAGG - Intergenic
1040156459 8:44200104-44200126 GAGAACACACATCACAATCAAGG - Intergenic
1040156630 8:44202653-44202675 GAGAACACACATCACAATCAAGG - Intergenic
1040156708 8:44203847-44203869 GAGAACACACATCACAATCAAGG - Intergenic
1040157106 8:44209623-44209645 GAGAACACACATCACAATCAAGG - Intergenic
1040157187 8:44210816-44210838 GAGAACACACACCACAATCAAGG - Intergenic
1040157312 8:44212684-44212706 GAGAACACACATCACAATCAAGG - Intergenic
1040157440 8:44214552-44214574 GAGAACACACATCACAATCAAGG - Intergenic
1040157705 8:44218457-44218479 GAGAACACACATCACAATCAAGG - Intergenic
1040157923 8:44221681-44221703 GAGAACACACATCACAATCAAGG - Intergenic
1040158185 8:44225586-44225608 GAGAACACACATCACAATCAAGG - Intergenic
1040158287 8:44227117-44227139 GAGAACACACATCACAATCAAGG - Intergenic
1040158367 8:44228311-44228333 GAGAACACACATCACAATCAAGG - Intergenic
1040158781 8:44234363-44234385 GAGAACACACATCACAATCAAGG - Intergenic
1040158998 8:44237594-44237616 GAGAACACACATCACAATCAAGG - Intergenic
1040159168 8:44240143-44240165 GAGAACACACATCACAATCAAGG - Intergenic
1040159340 8:44242692-44242714 GAGAACACACATCACAATCAAGG - Intergenic
1040159418 8:44243885-44243907 GAGAACACACATCACAATCAAGG - Intergenic
1040159499 8:44245078-44245100 GAGAACACACATCACAATCAAGG - Intergenic
1040159579 8:44246271-44246293 GAGAACACACATCACAATCAAGG - Intergenic
1040159704 8:44248139-44248161 GAGAACACACATCACAATCCAGG - Intergenic
1040159832 8:44250008-44250030 GAGAACACACATCACAATCAAGG - Intergenic
1040159953 8:44251877-44251899 GAGAACACACATCACAATCAAGG - Intergenic
1040160080 8:44253746-44253768 GAGAACACACATCACAATCAAGG - Intergenic
1040160159 8:44254939-44254961 GAGAACACACATCACAATCAAGG - Intergenic
1040160362 8:44258000-44258022 GAGAACACACATCACAATCAAGG - Intergenic
1040160571 8:44261062-44261084 GAGAACACACATCACAATCAAGG - Intergenic
1040160648 8:44262255-44262277 GAGAACACACATCACAATCAAGG - Intergenic
1040160906 8:44265993-44266015 GAGAACACACACCACAATCAAGG - Intergenic
1040161076 8:44268543-44268565 GAGAACACACATCACAATCAAGG - Intergenic
1040161156 8:44269736-44269758 GAGAACACACATCACAATCAAGG - Intergenic
1040161328 8:44272287-44272309 GAGAACACACATCACAATCAAGG - Intergenic
1040161460 8:44274157-44274179 GAGAACACACATCACAATCAAGG - Intergenic
1040161589 8:44276025-44276047 GAGAACACACATCACAATCAAGG - Intergenic
1040161668 8:44277218-44277240 GAGAACACACATCACAATCAAGG - Intergenic
1040161748 8:44278411-44278433 GAGAACACACATCACAATCAAGG - Intergenic
1040162102 8:44283671-44283693 GAGAACACACATCACAATCAAGG - Intergenic
1040162181 8:44284864-44284886 GAGAACACACATCACAATCAAGG - Intergenic
1040162445 8:44288771-44288793 GAGAACACACATCACAATCAAGG - Intergenic
1040162618 8:44291321-44291343 GAGAACACACATCACAATCAAGG - Intergenic
1040162820 8:44294210-44294232 GAGAACACACATCACAATCCAGG - Intergenic
1040163040 8:44297438-44297460 GAGAACACACATCACAATCAAGG - Intergenic
1040163441 8:44303376-44303398 GAGAACACACATCACAATCAAGG - Intergenic
1040163570 8:44305245-44305267 GAGAACACACATCACAATCAAGG - Intergenic
1040163791 8:44308470-44308492 GAGAACACACATCACAATCAAGG - Intergenic
1040163871 8:44309663-44309685 GAGAACACACATCACAATCAAGG - Intergenic
1040163952 8:44310856-44310878 GAGAACACACATCACAATCAAGG - Intergenic
1040164123 8:44313408-44313430 GAGAACACACATCACAATCAAGG - Intergenic
1040164330 8:44316470-44316492 GAGAACACACATCACAATCCAGG - Intergenic
1040164457 8:44318341-44318363 GAGAACACACATCACAATCAAGG - Intergenic
1040164539 8:44319535-44319557 GAGAACACACATCACAATCAAGG - Intergenic
1040164802 8:44323443-44323465 GAGAACACACATCACAATCAAGG - Intergenic
1040164882 8:44324636-44324658 GAGAACACACATCACAATCAAGG - Intergenic
1040164962 8:44325829-44325851 GAGAACACACATCACAATCAAGG - Intergenic
1040165086 8:44327697-44327719 GAGAACACACATCACAATCAAGG - Intergenic
1040165165 8:44328890-44328912 GAGAACACACATCACAATCAAGG - Intergenic
1040165555 8:44334664-44334686 GAGAACACACATCACAATCAAGG - Intergenic
1040165726 8:44337213-44337235 GAGAACACACATCACAATCAAGG - Intergenic
1040165901 8:44339762-44339784 GAGAACACACATCACAATCAAGG - Intergenic
1040166118 8:44342987-44343009 GAGAACACACATCACAATCAAGG - Intergenic
1040166200 8:44344181-44344203 GAGAACACACATCACAATCAAGG - Intergenic
1040166464 8:44348087-44348109 GAGAACACACATCACAATCAAGG - Intergenic
1040166542 8:44349282-44349304 GAGAACACACATCACAATCAAGG - Intergenic
1040166622 8:44350475-44350497 GAGAACACACATCACAATCAAGG - Intergenic
1040166702 8:44351668-44351690 GAGAACACACATCACAATCAAGG - Intergenic
1040166820 8:44353536-44353558 GAGAACACACATCACAATCAAGG - Intergenic
1040166991 8:44356084-44356106 GAGAACACACATCACAATCAAGG - Intergenic
1040167072 8:44357278-44357300 GAGAACACACATCACAATCAAGG - Intergenic
1040167462 8:44363053-44363075 GAGAACACACATCACAATCAAGG - Intergenic
1040167773 8:44367633-44367655 GAGAACACACATCACAATCAAGG - Intergenic
1040167854 8:44368826-44368848 GAGAACACACATCACAATCAAGG - Intergenic
1040167934 8:44370019-44370041 GAGAACACACATCACAATCAAGG - Intergenic
1040168284 8:44375114-44375136 GAGAACACACATCACAATCAAGG - Intergenic
1040168409 8:44376983-44377005 GAGAACACACATCACAATCAAGG - Intergenic
1040168489 8:44378176-44378198 GAGAACACACATCACAATCAAGG - Intergenic
1040168569 8:44379369-44379391 GAGAACACACATCACAATCAAGG - Intergenic
1040168696 8:44381238-44381260 GAGAACACACATCACAATCAAGG - Intergenic
1040168823 8:44383107-44383129 GAGAACACACATCACAATCAAGG - Intergenic
1040168943 8:44384977-44384999 GAGAACACACATCACAATCAAGG - Intergenic
1040169070 8:44386845-44386867 GAGAACACACATCACAATCAAGG - Intergenic
1040169151 8:44388038-44388060 GAGAACACACATCACAATCAAGG - Intergenic
1040169279 8:44389906-44389928 GAGAACACACATCACAATCAAGG - Intergenic
1040169359 8:44391100-44391122 GAGAACACACATCACAATCAAGG - Intergenic
1040169438 8:44392293-44392315 GAGAACACACATCACAATCAAGG - Intergenic
1040169610 8:44394842-44394864 GAGAACACACATCACAATCAAGG - Intergenic
1040169737 8:44396710-44396732 GAGAACACACATCACAATCAAGG - Intergenic
1040169861 8:44398580-44398602 GAGAACACACATCACAATCAAGG - Intergenic
1040170035 8:44401130-44401152 GAGAACACACATCACAATCAAGG - Intergenic
1040170162 8:44402998-44403020 GAGAACACACATCACAATCAAGG - Intergenic
1040170337 8:44405547-44405569 GAGAACACACATCACAATCAAGG - Intergenic
1040170647 8:44410129-44410151 GAGAACACACATCACAATCAAGG - Intergenic
1040170864 8:44413355-44413377 GAGAACACACATCACAATCAAGG - Intergenic
1040171288 8:44419633-44419655 GAGAACACACATCACAATCAAGG - Intergenic
1040171368 8:44420826-44420848 GAGAACACACATCACAATCAAGG - Intergenic
1040171494 8:44422693-44422715 GAGAACACACATCACAATCAAGG - Intergenic
1040171574 8:44423888-44423910 GAGAACACACATCACAATCAAGG - Intergenic
1040171750 8:44426437-44426459 GAGAACACACATCACAATCCAGG - Intergenic
1040172003 8:44430175-44430197 GAGAACACACATCACAATCAAGG - Intergenic
1040172082 8:44431369-44431391 GAGAACACACATCACAATCAAGG - Intergenic
1040172257 8:44433919-44433941 GAGAACACACATCACAATCAAGG - Intergenic
1040172384 8:44435789-44435811 GAGAACACACATCACAATCAAGG - Intergenic
1040172636 8:44439531-44439553 GAGAACACACATCACAATCAAGG - Intergenic
1040172718 8:44440724-44440746 GAGAACACACATCACAATCAAGG - Intergenic
1040172891 8:44443275-44443297 GAGAACACACATCACAATCAAGG - Intergenic
1040173064 8:44445824-44445846 GAGAACACACATCACAATCAAGG - Intergenic
1040173145 8:44447017-44447039 GAGAACACACATCACAATCAAGG - Intergenic
1040173226 8:44448211-44448233 GAGAACACACATCACAATCAAGG - Intergenic
1040173307 8:44449404-44449426 GAGAACACACATCACAATCAAGG - Intergenic
1040173388 8:44450597-44450619 GAGAACACACATCACAATCAAGG - Intergenic
1040173468 8:44451790-44451812 GAGAACACACATCACAATCAAGG - Intergenic
1040173550 8:44452984-44453006 GAGAACACACATCACAATCAAGG - Intergenic
1040173676 8:44454854-44454876 GAGAACACACATCACAATCAAGG - Intergenic
1040173804 8:44456722-44456744 GAGAACACACATCACAATCAAGG - Intergenic
1040173930 8:44458591-44458613 GAGAACACACATCACAATCAAGG - Intergenic
1040174051 8:44460460-44460482 GAGAACACACATCACAATCAAGG - Intergenic
1040174177 8:44462328-44462350 GAGAACACACATCACAATCAAGG - Intergenic
1040174257 8:44463521-44463543 GAGAACACACATCACAATCAAGG - Intergenic
1040174522 8:44467427-44467449 GAGAACACACATCACAATCAAGG - Intergenic
1040174740 8:44470652-44470674 GAGAACACACATCACAATCAAGG - Intergenic
1040174820 8:44471845-44471867 GAGAACACACATCACAATCAAGG - Intergenic
1040174992 8:44474395-44474417 GAGAACACACATCACAATCAAGG - Intergenic
1040175072 8:44475589-44475611 GAGAACACACATCACAATCAAGG - Intergenic
1040175153 8:44476782-44476804 GAGAACACACATCACAATCAAGG - Intergenic
1040175541 8:44482558-44482580 GAGAACACACATCACAATCAAGG - Intergenic
1040175622 8:44483753-44483775 GAGAACACACATCACAATCAAGG - Intergenic
1040175753 8:44485620-44485642 GAGAACACACATCACAATCAAGG - Intergenic
1040175879 8:44487489-44487511 GAGAACACACATCACAATCAAGG - Intergenic
1040176009 8:44489357-44489379 GAGAACACACATCACAATCAAGG - Intergenic
1040176110 8:44490888-44490910 GAGAACACACATCACAATCAAGG - Intergenic
1040176376 8:44494793-44494815 GAGAACACACATCACAATCAAGG - Intergenic
1040176456 8:44495986-44496008 GAGAACACACATCACAATCAAGG - Intergenic
1040176537 8:44497181-44497203 GAGAACACACATCACAATCAAGG - Intergenic
1040176618 8:44498374-44498396 GAGAACACACATCACAATCAAGG - Intergenic
1040176927 8:44502954-44502976 GAGAACACACATCACAATCAAGG - Intergenic
1040177100 8:44505503-44505525 GAGAACACACATCACAATCAAGG - Intergenic
1040177228 8:44507373-44507395 GAGAACACACATCACAATCAAGG - Intergenic
1040177361 8:44509242-44509264 GAGAACACACATCACAATCCAGG - Intergenic
1040177488 8:44511111-44511133 GAGAACACACATCACAATCAAGG - Intergenic
1040177838 8:44516378-44516400 GAGAACACACATCACAATCAAGG - Intergenic
1040177965 8:44518246-44518268 GAGAACACACATCACAATCAAGG - Intergenic
1040178044 8:44519439-44519461 GAGAACACACATCACAATCAAGG - Intergenic
1040178123 8:44520633-44520655 GAGAACACACATCACAATCAAGG - Intergenic
1040178424 8:44525051-44525073 GAGAACACACATCACAATCAAGG - Intergenic
1040178504 8:44526244-44526266 GAGAACACACATCACAATCAAGG - Intergenic
1040178678 8:44528794-44528816 GAGAACACACATCACAATCAAGG - Intergenic
1040178759 8:44529987-44530009 GAGAACACACATCACAATCAAGG - Intergenic
1040179012 8:44533725-44533747 GAGAACACACATCACAATCAAGG - Intergenic
1040179092 8:44534918-44534940 GAGAACACACATCACAATCAAGG - Intergenic
1040179309 8:44538143-44538165 GAGAACACACATCACAATCAAGG - Intergenic
1040179389 8:44539336-44539358 GAGAACACACATCACAATCAAGG - Intergenic
1040179471 8:44540531-44540553 GAGAACACACATCACAATCAAGG - Intergenic
1040179636 8:44543080-44543102 GAGAACACACATCACAATCAAGG - Intergenic
1040179716 8:44544273-44544295 GAGAACACACATCACAATCAAGG - Intergenic
1040179888 8:44546822-44546844 GAGAACACACATCACAATCAAGG - Intergenic
1040180014 8:44548690-44548712 GAGAACACACATCACAATCAAGG - Intergenic
1040180184 8:44551239-44551261 GAGAACACACATCACAATCAAGG - Intergenic
1040180539 8:44556499-44556521 GAGAACACACATCACAATCAAGG - Intergenic
1040180710 8:44559048-44559070 GAGAACACACATCACTATCAAGG - Intergenic
1040180791 8:44560241-44560263 GAGAACACACATCACAATCAAGG - Intergenic
1040180874 8:44561435-44561457 GAGAACACACATCACAATCAAGG - Intergenic
1040180954 8:44562629-44562651 GAGAACACACATCACAATCAAGG - Intergenic
1040181124 8:44565178-44565200 GAGAACACACATCACAATCAAGG - Intergenic
1040181344 8:44568401-44568423 GAGAACACACATCACAATCAAGG - Intergenic
1040181656 8:44572980-44573002 GAGAACACACATCACAATCAAGG - Intergenic
1040181735 8:44574173-44574195 GAGAACACACATCACAATCAAGG - Intergenic
1040181998 8:44578078-44578100 GAGAACACACATCACAATCAAGG - Intergenic
1040182163 8:44580464-44580486 GAGAACACACATCACAATCAAGG - Intergenic
1040182334 8:44583015-44583037 GAGAACACACATCACAATCAAGG - Intergenic
1040182413 8:44584209-44584231 GAGAACACACATCACAATCAAGG - Intergenic
1040182673 8:44588113-44588135 GAGAACACACATCACAATCAAGG - Intergenic
1040182753 8:44589307-44589329 GAGAACACACATCACAATCAAGG - Intergenic
1040182833 8:44590499-44590521 GAGAACACACATCACAATCAAGG - Intergenic
1040182996 8:44592886-44592908 GAGAACACACATCACAATCAAGG - Intergenic
1040183076 8:44594080-44594102 GAGAACACACATCACAATCAAGG - Intergenic
1040183157 8:44595274-44595296 GAGAACACACATCACAATCAAGG - Intergenic
1040183331 8:44597822-44597844 GAGAACACACATCACAATCAAGG - Intergenic
1040183412 8:44599015-44599037 GAGAACACACATCACAATCAAGG - Intergenic
1040183492 8:44600208-44600230 GAGAACACACATCACAATCAAGG - Intergenic
1040183572 8:44601401-44601423 GAGAACACACATCACAATCAAGG - Intergenic
1040183652 8:44602594-44602616 GAGAACACACATCACAATCAAGG - Intergenic
1040183872 8:44605818-44605840 GAGAACACACATCACAATCAAGG - Intergenic
1040183952 8:44607011-44607033 GAGAACACACATCACAATCAAGG - Intergenic
1040184125 8:44609560-44609582 GAGAACACACATCACAATCAAGG - Intergenic
1040184564 8:44616009-44616031 GAGAACACACATCACAATCAAGG - Intergenic
1040184713 8:44618221-44618243 GAGAACACACATCACAATCAAGG - Intergenic
1040185023 8:44622802-44622824 GAGAACACACATCACAATCAAGG - Intergenic
1040185287 8:44626707-44626729 GAGAACACACATCACAATCAAGG - Intergenic
1040185457 8:44629257-44629279 GAGAACACACATCACAATCAAGG - Intergenic
1040185537 8:44630450-44630472 GAGAACACACATCACAATCAAGG - Intergenic
1040185617 8:44631643-44631665 GAGAACACACATCACAATCAAGG - Intergenic
1040185698 8:44632838-44632860 GAGAACACACATCACAATCAAGG - Intergenic
1040185778 8:44634031-44634053 GAGAACACACATCACAATCAAGG - Intergenic
1040185908 8:44635899-44635921 GAGAACACACATCACAATCAAGG - Intergenic
1040186058 8:44638114-44638136 GAGAACACACATCACAATCAAGG - Intergenic
1040186139 8:44639307-44639329 GAGAACACACATCACAATCAAGG - Intergenic
1040186218 8:44640501-44640523 GAGAACACACATCACAATCAAGG - Intergenic
1040186478 8:44644408-44644430 GAGAACACACATCACAATCAAGG - Intergenic
1040186606 8:44646276-44646298 GAGAACACACATCACAATCAAGG - Intergenic
1040186688 8:44647469-44647491 GAGAACACACATCACAATCAAGG - Intergenic
1040186769 8:44648663-44648685 GAGAACACACATCACAATCAAGG - Intergenic
1040187078 8:44653245-44653267 GAGAACACACATCACAATCAAGG - Intergenic
1040187158 8:44654438-44654460 GAGAACACACATCACAATCAAGG - Intergenic
1040187284 8:44656307-44656329 GAGAACACACATCACAATCAAGG - Intergenic
1040187367 8:44657500-44657522 GAGAACACACATCACAATCCAGG - Intergenic
1040187448 8:44658695-44658717 GAGAACACACATCACAATCAAGG - Intergenic
1040187579 8:44660565-44660587 GAGAACACACATCACAATCAAGG - Intergenic
1040187706 8:44662433-44662455 GAGAACACACATCACAATCAAGG - Intergenic
1040187878 8:44664982-44665004 GAGAACACACATCACAATCAAGG - Intergenic
1040188279 8:44670921-44670943 GAGAACACACATCACAATCAAGG - Intergenic
1040188543 8:44674826-44674848 GAGAACACACATCACAATCAAGG - Intergenic
1040188714 8:44677375-44677397 GAGAACACACATCACAATCAAGG - Intergenic
1040188884 8:44679924-44679946 GAGAACACACATCACAATCAAGG - Intergenic
1040189239 8:44685187-44685209 GAGAACACACATCACAATCAAGG - Intergenic
1040189549 8:44689765-44689787 GAGAACACACATCACAATCAAGG - Intergenic
1040189629 8:44690958-44690980 GAGAACACACATCACAATCAAGG - Intergenic
1040189801 8:44693507-44693529 GAGAACACACATCACAATCAAGG - Intergenic
1040189883 8:44694700-44694722 GAGAACACACATCACAATCAAGG - Intergenic
1040190058 8:44697249-44697271 GAGAACACACATCACAATCAAGG - Intergenic
1040190183 8:44699117-44699139 GAGAACACACATCACAATCAAGG - Intergenic
1040190263 8:44700310-44700332 GAGAACACACATCACAATCAAGG - Intergenic
1040190607 8:44705406-44705428 GAGAACACACATCACAATCAAGG - Intergenic
1040190780 8:44707955-44707977 GAGAACACACATCACAATCAAGG - Intergenic
1040190860 8:44709146-44709168 GAGAACACACATCACAATCAAGG - Intergenic
1040190940 8:44710339-44710361 GAGAACACACATCACAATCAAGG - Intergenic
1040191020 8:44711532-44711554 GAGAACACACATCACAATCAAGG - Intergenic
1040191099 8:44712725-44712747 GAGAACACACATCACAATCAAGG - Intergenic
1040191270 8:44715274-44715296 GAGAACACACATCACAATCAAGG - Intergenic
1040191349 8:44716467-44716489 GAGAACACACATCACAATCAAGG - Intergenic
1040191524 8:44719016-44719038 GAGAACACACATCACAATCAAGG - Intergenic
1040191652 8:44720884-44720906 GAGAACACACATCACAATCAAGG - Intergenic
1040191803 8:44723099-44723121 GAGAACACACATCACAATCAAGG - Intergenic
1040191883 8:44724292-44724314 GAGAACACACATCACAATCAAGG - Intergenic
1040192055 8:44726841-44726863 GAGAACACACATCACAATCAAGG - Intergenic
1040192309 8:44730585-44730607 GAGAACACACATCACAATCAAGG - Intergenic
1040192433 8:44732454-44732476 GAGAACACACATCACAATCAAGG - Intergenic
1040192561 8:44734322-44734344 GAGAACACACATCACAATCAAGG - Intergenic
1040192691 8:44736190-44736212 GAGAACACACATCACAATCCAGG - Intergenic
1040192817 8:44738059-44738081 GAGAACACACATCACAATCAAGG - Intergenic
1040192949 8:44739928-44739950 GAGAACACACATCACAATCAAGG - Intergenic
1040193076 8:44741797-44741819 GAGAACACACATCACAATCAAGG - Intergenic
1040193327 8:44745539-44745561 GAGAACACACATCACAATCAAGG - Intergenic
1040193453 8:44747414-44747436 GAGAACACACATCACAATCAAGG - Intergenic
1040193621 8:44749963-44749985 GAGAACACACATCACAATCAAGG - Intergenic
1040193794 8:44752511-44752533 GAGAACACACATCACAATCAAGG - Intergenic
1040193955 8:44754900-44754922 GAGAACACACATCACAATCAAGG - Intergenic
1040194039 8:44756092-44756114 GAGAACACACATCACAATCAAGG - Intergenic
1040194119 8:44757286-44757308 GAGAACACACATCACAATCAAGG - Intergenic
1040194199 8:44758479-44758501 GAGAACACACATCACAATCAAGG - Intergenic
1040194498 8:44762897-44762919 GAGAACACACATCACAATCAAGG - Intergenic
1040194762 8:44766806-44766828 GAGAACACACATCACAATCAAGG - Intergenic
1040194934 8:44769355-44769377 GAGAACACACATCACAATCAAGG - Intergenic
1040195013 8:44770548-44770570 GAGAACACACATCACAATCAAGG - Intergenic
1040195138 8:44772423-44772445 GAGAACACACATCACAATCAAGG - Intergenic
1040195218 8:44773617-44773639 GAGAACACACATCACAATCAAGG - Intergenic
1040195480 8:44777521-44777543 GAGAACACACATCACAATCAAGG - Intergenic
1040195607 8:44779389-44779411 GAGAACACACATCACAATCAAGG - Intergenic
1040195690 8:44780582-44780604 GAGAACACACATCACAATCAAGG - Intergenic
1040195770 8:44781767-44781789 GAGAACACACATCACAATCAAGG - Intergenic
1040195893 8:44783637-44783659 GAGAACACACATCACAATCAAGG - Intergenic
1040195970 8:44784831-44784853 GAGAACACACATCACAATCAAGG - Intergenic
1040196097 8:44786699-44786721 GAGAACACACATCACAATCAAGG - Intergenic
1040196271 8:44789249-44789271 GAGAACACACATCACAATCAAGG - Intergenic
1040196527 8:44792986-44793008 GAGAACACACATCACAATCCAGG - Intergenic
1040196607 8:44794179-44794201 GAGAACACACATCACAATCCAGG - Intergenic
1040196739 8:44796047-44796069 GAGAACACACATCACAATCAAGG - Intergenic
1040196819 8:44797239-44797261 GAGAACACACATCACAATCAAGG - Intergenic
1040196899 8:44798432-44798454 GAGAACACACATCACAATCAAGG - Intergenic
1040197321 8:44804723-44804745 GAGAACACACATCACAATCAAGG - Intergenic
1040197449 8:44806592-44806614 GAGAACACACATCACAATCAAGG - Intergenic
1040197529 8:44807786-44807808 GAGAACACACATCACAATCAAGG - Intergenic
1040197841 8:44812367-44812389 GAGAACACACATCACAATCAAGG - Intergenic
1040197967 8:44814235-44814257 GAGAACACACATCACAATCAAGG - Intergenic
1040198048 8:44815426-44815448 GAGAACACACATCACAATCAAGG - Intergenic
1040198128 8:44816619-44816641 GAGAACACACATCACAATCAAGG - Intergenic
1040198252 8:44818488-44818510 GAGAACACACATCACAATCAAGG - Intergenic
1040198513 8:44822395-44822417 GAGAACACACATCACAATCAAGG - Intergenic
1040198592 8:44823588-44823610 GAGAACACACATCACAATCAAGG - Intergenic
1040198811 8:44826812-44826834 GAGAACACACATCACAATCAAGG - Intergenic
1040198935 8:44828680-44828702 GAGAACACACATCACAATCAAGG - Intergenic
1040199056 8:44830548-44830570 GAGAACACACATCACAATCAAGG - Intergenic
1040199136 8:44831741-44831763 GAGAACACACATCACAATCAAGG - Intergenic
1040199353 8:44834965-44834987 GAGAACACACATCACAATCAAGG - Intergenic
1040199430 8:44836158-44836180 GAGAACACACATCACAATCAAGG - Intergenic
1040199509 8:44837351-44837373 GAGAACACACATCACAATCAAGG - Intergenic
1040199635 8:44839219-44839241 GAGAACACACATCACAATCAAGG - Intergenic
1040199764 8:44841086-44841108 GAGAACACACATCACAATCAAGG - Intergenic
1040199844 8:44842279-44842301 GAGAACACACATCACAATCAAGG - Intergenic
1040200016 8:44844828-44844850 GAGAACACACATCACAATCAAGG - Intergenic
1040200370 8:44850090-44850112 GAGAACACACATCACAATCAAGG - Intergenic
1040200452 8:44851284-44851306 GAGAACACACATCACAATCAAGG - Intergenic
1040200667 8:44854508-44854530 GAGAACACACATCACAATCAAGG - Intergenic
1040200748 8:44855703-44855725 GAGAACACACATCACAATCAAGG - Intergenic
1040200828 8:44856896-44856918 GAGAACACACATCACAATCAAGG - Intergenic
1040200957 8:44858766-44858788 GAGAACACACATCACAATCAAGG - Intergenic
1040201038 8:44859959-44859981 GAGAACACACATCACAATCAAGG - Intergenic
1040201392 8:44865221-44865243 GAGAACACACATCACAATCAAGG - Intergenic
1040201707 8:44869801-44869823 GAGAACACACATCACAATCAAGG - Intergenic
1040201787 8:44870994-44871016 GAGAACACACATCACAATCAAGG - Intergenic
1040201867 8:44872188-44872210 GAGAACACACATCACAATCAAGG - Intergenic
1040201992 8:44874056-44874078 GAGAACACACATCACAATCAAGG - Intergenic
1040202113 8:44875924-44875946 GAGAACACACATCACAATCAAGG - Intergenic
1040202511 8:44881865-44881887 GAGAACACACACCACAATCAAGG - Intergenic
1040202590 8:44883058-44883080 GAGAACACACATCACAATCAAGG - Intergenic
1040202926 8:44887987-44888009 GAGAACACACATCACAATCAAGG - Intergenic
1040203370 8:44894604-44894626 GAGAACACACATCACAATCAAGG - Intergenic
1040203450 8:44895797-44895819 GAGAACACACATCACAATCAAGG - Intergenic
1040203530 8:44896991-44897013 GAGAACACACATCACAATCAAGG - Intergenic
1040203701 8:44899540-44899562 GAGAACACACATCACAATCAAGG - Intergenic
1040203781 8:44900733-44900755 GAGAACACACATCACAATCAAGG - Intergenic
1040203859 8:44901927-44901949 GAGAACACACATCACAATCAAGG - Intergenic
1040204005 8:44904134-44904156 GAGAACACACATCACAATCAAGG - Intergenic
1040204086 8:44905327-44905349 GAGAACACACATCACAATCAAGG - Intergenic
1040204259 8:44907876-44907898 GAGAACACACATCACAATCAAGG - Intergenic
1040204523 8:44911781-44911803 GAGAACACACATCACAATCAAGG - Intergenic
1040204600 8:44912974-44912996 GAGAACACACATCACAATCAAGG - Intergenic
1040204728 8:44914841-44914863 GAGAACACACATCACAATCAAGG - Intergenic
1040205036 8:44919419-44919441 GAGAACACACATCACAATCAAGG - Intergenic
1040205484 8:44926036-44926058 GAGAACACACATCACAATCAAGG - Intergenic
1040206140 8:44935708-44935730 GAGAACACACATCACAATCAAGG - Intergenic
1040206219 8:44936901-44936923 GAGAACACACATCACAATCAAGG - Intergenic
1040206299 8:44938094-44938116 GAGAACACACATCACAATCAAGG - Intergenic
1040206427 8:44939964-44939986 GAGAACACACATCACAATCAAGG - Intergenic
1040206645 8:44943189-44943211 GAGAACACACATCACAATCAAGG - Intergenic
1040207184 8:44951164-44951186 GAGAACACACATCACAATCAAGG - Intergenic
1040207421 8:44954726-44954748 GAGAACACACATCACAATCAAGG - Intergenic
1040207641 8:44957951-44957973 GAGAACACACATCACAATCAAGG - Intergenic
1040207769 8:44959819-44959841 GAGAACACACATCACAATCAAGG - Intergenic
1040208058 8:44964066-44964088 GAGAACACACATCACAATCAAGG - Intergenic
1040208184 8:44965936-44965958 GAGAACACACATCACAATCAAGG - Intergenic
1040208263 8:44967130-44967152 GAGAACACACATCACAATCAAGG - Intergenic
1040208893 8:44976460-44976482 GAGAACACACATCACAATCAAGG - Intergenic
1040209018 8:44978332-44978354 GAGAACACACATCACAATCAAGG - Intergenic
1040209190 8:44980880-44980902 GAGAACACACATCACAATCAAGG - Intergenic
1040209311 8:44982749-44982771 GAGAACACACATCACAATCAAGG - Intergenic
1040209391 8:44983942-44983964 GAGAACACACATCACAATCAAGG - Intergenic
1040209517 8:44985812-44985834 GAGAACACACATCACAATCAAGG - Intergenic
1040209868 8:44991074-44991096 GAGAACACACATCACAATCAAGG - Intergenic
1040210043 8:44993620-44993642 GAGAACACACATCACAATCAAGG - Intergenic
1040210396 8:44998881-44998903 GAGAACACACATCACAATCAAGG - Intergenic
1040210523 8:45000750-45000772 GAGAACACACATCACAATCAAGG - Intergenic
1040210738 8:45003973-45003995 GAGAACACACATCACAATCAAGG - Intergenic
1040210866 8:45005842-45005864 GAGAACACACATCACAATCAAGG - Intergenic
1040211040 8:45008391-45008413 GAGAACACACATCACAATCAAGG - Intergenic
1040211120 8:45009586-45009608 GAGAACACACATCACAATCAAGG - Intergenic
1040211244 8:45011455-45011477 GAGAACACACATCACAATCAAGG - Intergenic
1040211372 8:45013324-45013346 GAGAACACACATCACAATCAAGG - Intergenic
1040211496 8:45015192-45015214 GAGAACACACATCACAATCAAGG - Intergenic
1040211626 8:45017059-45017081 GAGAACACACATCACAATCAAGG - Intergenic
1040211882 8:45020796-45020818 GAGAACACACATCACAATCAAGG - Intergenic
1040212236 8:45026058-45026080 GAGAACACACATCACAATCAAGG - Intergenic
1040212362 8:45027928-45027950 GAGAACACACATCACAATCAAGG - Intergenic
1040212536 8:45030479-45030501 GAGAACACACATCACAATCAAGG - Intergenic
1040212665 8:45032348-45032370 GAGAACACACATCACAATCAAGG - Intergenic
1040212788 8:45034216-45034238 GAGAACACACATCACAATCAAGG - Intergenic
1040212916 8:45036085-45036107 GAGAACACACATCACAATCAAGG - Intergenic
1040213045 8:45037955-45037977 GAGAACACACATCACAATCAAGG - Intergenic
1040213126 8:45039148-45039170 GAGAACACACATCACAATCAAGG - Intergenic
1040213207 8:45040340-45040362 GAGAACACACACCACAATCAAGG - Intergenic
1040213335 8:45042208-45042230 GAGAACACACATCACAATCAAGG - Intergenic
1040213417 8:45043402-45043424 GAGAACACACATCACAATCAAGG - Intergenic
1040213497 8:45044594-45044616 GAGAACACACATCACAATCAAGG - Intergenic
1040213577 8:45045787-45045809 GAGAACACACATCACAATCAAGG - Intergenic
1040213707 8:45047658-45047680 GAGAACACACATCACAATCAAGG - Intergenic
1040213877 8:45050206-45050228 GAGAACACACATCACAATCAAGG - Intergenic
1040214002 8:45052074-45052096 GAGAACACACATCACAATCAAGG - Intergenic
1040214357 8:45057338-45057360 GAGAACACACATCACAATCAAGG - Intergenic
1040214484 8:45059208-45059230 GAGAACACACATCACAATCAAGG - Intergenic
1040214656 8:45061758-45061780 GAGAACACACATCACAATCAAGG - Intergenic
1040214829 8:45064307-45064329 GAGAACACACATCACAATCAAGG - Intergenic
1040215000 8:45066856-45066878 GAGAACACACATCACAATCAAGG - Intergenic
1040215127 8:45068725-45068747 GAGAACACACATCACAATCAAGG - Intergenic
1040215390 8:45072630-45072652 GAGAACACACATCACAATCAAGG - Intergenic
1040215655 8:45076533-45076555 GAGAACACACATCACAATCAAGG - Intergenic
1040215735 8:45077726-45077748 GAGAACACACATCACAATCAAGG - Intergenic
1040215817 8:45078919-45078941 GAGAACACACATCACAATCAAGG - Intergenic
1040215972 8:45081297-45081319 GAGAACACACATCACAATCAAGG - Intergenic
1040216050 8:45082486-45082508 GAGAACACACATCACAATCAAGG - Intergenic
1040216131 8:45083679-45083701 GAGAACACACATCACAATCAAGG - Intergenic
1040216212 8:45084873-45084895 GAGAACACACATCACAATCAAGG - Intergenic
1040216293 8:45086066-45086088 GAGAACACACATCACAATCAAGG - Intergenic
1040216421 8:45087935-45087957 GAGAACACACATCACAATCAAGG - Intergenic
1040216685 8:45091841-45091863 GAGAACACACATCACAATCAAGG - Intergenic
1040216951 8:45095745-45095767 GAGAACACACATCACAATCAAGG - Intergenic
1040217125 8:45098296-45098318 GAGAACACACATCACAATCAAGG - Intergenic
1040217209 8:45099488-45099510 GAGAACACACATCACAATCCAGG - Intergenic
1040217382 8:45102038-45102060 GAGAACACACATCACAATCAAGG - Intergenic
1040217509 8:45103908-45103930 GAGAACACACATCACAATCAAGG - Intergenic
1040217635 8:45105777-45105799 GAGAACACACATCACAATCAAGG - Intergenic
1040217716 8:45106970-45106992 GAGAACACACATCACAATCAAGG - Intergenic
1040217845 8:45108840-45108862 GAGAACACACATCACAATCAAGG - Intergenic
1040217926 8:45110034-45110056 GAGAACACACACCACAATCAAGG - Intergenic
1040218004 8:45111227-45111249 GAGAACACACATCACAATCAAGG - Intergenic
1040218083 8:45112420-45112442 GAGAACACACATCACAATCAAGG - Intergenic
1040218256 8:45114970-45114992 GAGAACACACATCACAATCAAGG - Intergenic
1040218476 8:45118194-45118216 GAGAACACACATCACAATCAAGG - Intergenic
1040218646 8:45120743-45120765 GAGAACACACATCACAATCCAGG - Intergenic
1040218817 8:45123293-45123315 GAGAACACACATCACAATCAAGG - Intergenic
1040218895 8:45124482-45124504 GAGAACACACATCACAATCAAGG - Intergenic
1040219100 8:45127540-45127562 GAGAACACACATCACAATCAAGG - Intergenic
1040219272 8:45130090-45130112 GAGAACACACATCACAATCAAGG - Intergenic
1040219399 8:45131958-45131980 GAGAACACACATCACAATCAAGG - Intergenic
1040219617 8:45135181-45135203 GAGAACACACATCACAATCAAGG - Intergenic
1040219835 8:45138407-45138429 GAGAACACACATCACAATCAAGG - Intergenic
1040219965 8:45140275-45140297 GAGAACACACATCACAATCAAGG - Intergenic
1040220369 8:45146211-45146233 GAGAACACACATCACAATCAAGG - Intergenic
1040220450 8:45147404-45147426 GAGAACACACATCACAATCAAGG - Intergenic
1040220530 8:45148597-45148619 GAGAACACACATCACAATCAAGG - Intergenic
1040220610 8:45149790-45149812 GAGAACACACATCACAATCAAGG - Intergenic
1040220827 8:45153014-45153036 GAGAACACACATCACAATCAAGG - Intergenic
1040220906 8:45154207-45154229 GAGAACACACATCACAATCAAGG - Intergenic
1040221123 8:45157432-45157454 GAGAACACACATCACAATCAAGG - Intergenic
1040221295 8:45159981-45160003 GAGAACACACATCACAATCAAGG - Intergenic
1040221375 8:45161174-45161196 GAGAACACACATCACAATCAAGG - Intergenic
1040221639 8:45165079-45165101 GAGAACACACATCACAATCCAGG - Intergenic
1040221768 8:45166948-45166970 GAGAACACACATCACAATCAAGG - Intergenic
1040221845 8:45168141-45168163 GAGAACACACATCACAATCAAGG - Intergenic
1040222111 8:45172047-45172069 GAGAACACACATCACAATCAAGG - Intergenic
1040222193 8:45173240-45173262 GAGAACACACATCACAATCAAGG - Intergenic
1040222503 8:45177821-45177843 GAGAACACACATCACAATCAAGG - Intergenic
1040222719 8:45181044-45181066 GAGAACACACATCACAATCAAGG - Intergenic
1040222799 8:45182237-45182259 GAGAACACACATCACAATCAAGG - Intergenic
1040223109 8:45186816-45186838 GAGAACACACATCACAATCAAGG - Intergenic
1040223228 8:45188684-45188706 GAGAACACACATCACAATCAAGG - Intergenic
1040223308 8:45189877-45189899 GAGAACACACATCACAATCAAGG - Intergenic
1040223433 8:45191746-45191768 GAGAACACACATCACAATCAAGG - Intergenic
1040223699 8:45195651-45195673 GAGAACACACATCACAATCAAGG - Intergenic
1040223989 8:45199440-45199462 GAGAACACACATCACAATCAAGG - Intergenic
1040224115 8:45201308-45201330 GAGAACACACATCACAATCAAGG - Intergenic
1040224196 8:45202501-45202523 GAGAACACACATCACAATCAAGG - Intergenic
1040224319 8:45204370-45204392 GAGAACACACATCACAATCAAGG - Intergenic
1040224443 8:45206238-45206260 GAGAACACACATCACAATCAAGG - Intergenic
1040224569 8:45208107-45208129 GAGAACACACATCACAATCAAGG - Intergenic
1040224648 8:45209301-45209323 GAGAACACACATCACAATCAAGG - Intergenic
1040224993 8:45214397-45214419 GAGAACACACATCACAATCAAGG - Intergenic
1040225119 8:45216266-45216288 GAGAACACACATCACAATCAAGG - Intergenic
1040225384 8:45220168-45220190 GAGAACACACATCACAATCAAGG - Intergenic
1040225647 8:45224073-45224095 GAGAACACACATCACAATCAAGG - Intergenic
1040225725 8:45225266-45225288 GAGAACACACATCACAATCAAGG - Intergenic
1040225995 8:45229170-45229192 GAGAACACACATCACAATCAAGG - Intergenic
1040226126 8:45231039-45231061 GAGAACACACATCACAATCAAGG - Intergenic
1040226296 8:45233589-45233611 GAGAACACACATCACAATCAAGG - Intergenic
1040226426 8:45235457-45235479 GAGAACACACATCACAATCAAGG - Intergenic
1040226552 8:45237325-45237347 GAGAACACACATCACAATCAAGG - Intergenic
1040226631 8:45238520-45238542 GAGAACACACATCACAATCAAGG - Intergenic
1040227025 8:45244296-45244318 GAGAACACACATCACAATCAAGG - Intergenic
1040227153 8:45246166-45246188 GAGAACACACATCACAATCAAGG - Intergenic
1040227281 8:45248034-45248056 GAGAACACACATCACAATCAAGG - Intergenic
1040227362 8:45249227-45249249 GAGAACACACATCACAATCAAGG - Intergenic
1040227489 8:45251095-45251117 GAGAACACACATCACAATCAAGG - Intergenic
1040227569 8:45252288-45252310 GAGAACACACATCACAATCAAGG - Intergenic
1040227695 8:45254157-45254179 GAGAACACACATCACAATCAAGG - Intergenic
1040227949 8:45257901-45257923 GAGAACACACATCACAATCAAGG - Intergenic
1040228028 8:45259094-45259116 GAGAACACACATCACAATCAAGG - Intergenic
1040228108 8:45260287-45260309 GAGAACACACATCACAATCAAGG - Intergenic
1040228236 8:45262157-45262179 GAGAACACACATCACAATCAAGG - Intergenic
1040228360 8:45264024-45264046 GAGAACACACATCACAATCAAGG - Intergenic
1040228440 8:45265217-45265239 GAGAACACACATCACAATCAAGG - Intergenic
1040228751 8:45269799-45269821 GAGAACACACATCACAATCAAGG - Intergenic
1040228879 8:45271667-45271689 GAGAACACACATCACAATCAAGG - Intergenic
1040229048 8:45274217-45274239 GAGAACACACATCACAATCAAGG - Intergenic
1040229129 8:45275411-45275433 GAGAACACACATCACAATCAAGG - Intergenic
1040229333 8:45278473-45278495 GAGAACACACATCACAATCAAGG - Intergenic
1040229511 8:45281023-45281045 GAGAACACACATCACAATCCAGG - Intergenic
1040229639 8:45282892-45282914 GAGAACACACATCACAATCAAGG - Intergenic
1040229808 8:45285441-45285463 GAGAACACACACCACAATCAAGG - Intergenic
1040229935 8:45287309-45287331 GAGAACACACATCACAATCAAGG - Intergenic
1040230063 8:45289179-45289201 GAGAACACACATCACAATCAAGG - Intergenic
1040230318 8:45292921-45292943 GAGAACACACATCACAATCAAGG - Intergenic
1040230445 8:45294791-45294813 GAGAACACACATCACAATCAAGG - Intergenic
1040230524 8:45295985-45296007 GAGAACACACATCACAATCAAGG - Intergenic
1040230746 8:45299213-45299235 GAGAACACACATCACAATCAAGG - Intergenic
1040230826 8:45300407-45300429 GAGAACACACATCACAATCAAGG - Intergenic
1040231403 8:45308893-45308915 GAGAACACACATCACAATCAAGG - Intergenic
1040231487 8:45310088-45310110 GAGAACACACATCACAATCAAGG - Intergenic
1040231751 8:45313995-45314017 GAGAACACACATCACAATCAAGG - Intergenic
1040232108 8:45319257-45319279 GAGAACACACATCACAATCAAGG - Intergenic
1040232234 8:45321127-45321149 GAGAACACACATCACAATCAAGG - Intergenic
1040232314 8:45322317-45322339 GAGAACACACATCACAATCAAGG - Intergenic
1040232394 8:45323510-45323532 GAGAACACACATCACAATCAAGG - Intergenic
1040232519 8:45325378-45325400 GAGAACACACATCACAATCAAGG - Intergenic
1040232601 8:45326570-45326592 GAGAACACACATCACAATCAAGG - Intergenic
1040232682 8:45327763-45327785 GAGAACACACATCACAATCAAGG - Intergenic
1040232762 8:45328957-45328979 GAGAACACACATCACAATCAAGG - Intergenic
1040232842 8:45330150-45330172 GAGAACACACATCACAATCAAGG - Intergenic
1040232921 8:45331343-45331365 GAGAACACACATCACAATCAAGG - Intergenic
1040233003 8:45332536-45332558 GAGAACACACATCACAATCAAGG - Intergenic
1040233268 8:45336440-45336462 GAGAACACACATCACAATCAAGG - Intergenic
1040233392 8:45338309-45338331 GAGAACACACATCACAATCAAGG - Intergenic
1040233519 8:45340177-45340199 GAGAACACACATCACAATCAAGG - Intergenic
1040233646 8:45342046-45342068 GAGAACACACATCACAATCAAGG - Intergenic
1040233725 8:45343239-45343261 GAGAACACACATCACAATCAAGG - Intergenic
1040233805 8:45344432-45344454 GAGAACACACATCACAATCAAGG - Intergenic
1040234134 8:45349113-45349135 GAGAACACACATCACAATCAAGG - Intergenic
1040234215 8:45350307-45350329 GAGAACACACATCACAATCAAGG - Intergenic
1040234434 8:45353537-45353559 GAGAACACACATCACAATCAAGG - Intergenic
1040234558 8:45355405-45355427 GAGAACACACATCACAATCAAGG - Intergenic
1040234870 8:45359981-45360003 GAGAACACACATCACAATCAAGG - Intergenic
1040235090 8:45363205-45363227 GAGAACACACATCACAATCAAGG - Intergenic
1040235265 8:45365754-45365776 GAGAACACACATCACAATCAAGG - Intergenic
1040235392 8:45367623-45367645 GAGAACACACATCACAATCAAGG - Intergenic
1040235518 8:45369492-45369514 GAGAACACACATCACAATCAAGG - Intergenic
1040235644 8:45371360-45371382 GAGAACACACATCACAATCAAGG - Intergenic
1040235768 8:45373230-45373252 GAGAACACACATCACAATCAAGG - Intergenic
1040236027 8:45376967-45376989 GAGAACACACATCACAATCCAGG - Intergenic
1040236154 8:45378836-45378858 GAGAACACACATCACAATCAAGG - Intergenic
1040236326 8:45381385-45381407 GAGAACACACATCACAATCAAGG - Intergenic
1040236450 8:45383253-45383275 GAGAACACACATCACAATCAAGG - Intergenic
1040236625 8:45385802-45385824 GAGAACACACATCACAATCAAGG - Intergenic
1040236843 8:45389030-45389052 GAGAACACACATCACAATCAAGG - Intergenic
1040237063 8:45392250-45392272 GAGAACACACATCACAATCCAGG - Intergenic
1040237233 8:45394800-45394822 GAGAACACACATCACAATCAAGG - Intergenic
1040237359 8:45396669-45396691 GAGAACACACATCACAATCAAGG - Intergenic
1040237576 8:45399893-45399915 GAGAACACACATCACAATCAAGG - Intergenic
1040237656 8:45401086-45401108 GAGAACACACACCACAATCCAGG - Intergenic
1040237922 8:45404994-45405016 GAGAACACACATCACAATCAAGG - Intergenic
1040238046 8:45406864-45406886 GAGAACACACATCACAATCAAGG - Intergenic
1040238127 8:45408058-45408080 GAGAACACACATCACAATCCAGG - Intergenic
1040238207 8:45409252-45409274 GAGAACACACATCACAATCAAGG - Intergenic
1040238519 8:45413836-45413858 GAGAACACACATCACAATCAAGG - Intergenic
1040238602 8:45415029-45415051 GAGAACACACATCACAATCAAGG - Intergenic
1040238688 8:45416222-45416244 GAGAACACACATCACAATCCAGG - Intergenic
1040238814 8:45418092-45418114 GAGAACACACATCACAATCAAGG - Intergenic
1040239033 8:45421318-45421340 GAGAACACACATCACAATCAAGG - Intergenic
1040239343 8:45425897-45425919 GAGAACACACATCACAATCAAGG - Intergenic
1040239464 8:45427758-45427780 GAGAACACACATCACAATCAAGG - Intergenic
1040239635 8:45430307-45430329 GAGAACACACATCACAATCAAGG - Intergenic
1040239764 8:45432175-45432197 GAGAACACACATCACAATCAAGG - Intergenic
1040240073 8:45436757-45436779 GAGAACACACATCACAATCAAGG - Intergenic
1040240291 8:45439982-45440004 GAGAACACACATCACAATCAAGG - Intergenic
1040240373 8:45441176-45441198 GAGAACACACATCACAATCAAGG - Intergenic
1040240499 8:45443044-45443066 GAGAACACACATCACAATCCAGG - Intergenic
1040240628 8:45444913-45444935 GAGAACACACATCACAATCAAGG - Intergenic
1040240885 8:45448650-45448672 GAGAACACACATCACAATCAAGG - Intergenic
1040241106 8:45451875-45451897 GAGAACACACATCACAATCAAGG - Intergenic
1040241317 8:45455100-45455122 GAGAACACACATCACAATCAAGG - Intergenic
1040241444 8:45456969-45456991 GAGAACACACATCACAATCAAGG - Intergenic
1040241526 8:45458165-45458187 GAGAACACACATCACAATCAAGG - Intergenic
1040241741 8:45461389-45461411 GAGAACACACATCACAATCAAGG - Intergenic
1040242099 8:45466649-45466671 GAGAACACACATCACAATCAAGG - Intergenic
1040242229 8:45468517-45468539 GAGAACACACATCACAATCCAGG - Intergenic
1040242539 8:45473099-45473121 GAGAACACACATCACAATCAAGG - Intergenic
1040242709 8:45475647-45475669 GAGAACACACATCACAATCAAGG - Intergenic
1040242836 8:45477517-45477539 GAGAACACACATCACAATCAAGG - Intergenic
1040242966 8:45479390-45479412 GAGAACACACATCACAATCAAGG - Intergenic
1040243135 8:45481939-45481961 GAGAACACACATCACAATCAAGG - Intergenic
1040243310 8:45484489-45484511 GAGAACACACATCACAATCAAGG - Intergenic
1040243440 8:45486356-45486378 GAGAACACACATCACAATCAAGG - Intergenic
1040243567 8:45488225-45488247 GAGAACACACATCACAATCAAGG - Intergenic
1040243787 8:45491449-45491471 GAGAACACACATCACAATCAAGG - Intergenic
1040243959 8:45493999-45494021 GAGAACACACATCACAATCAAGG - Intergenic
1040244062 8:45495530-45495552 GAGAACACACATCACAATCAAGG - Intergenic
1040244705 8:45504870-45504892 GAGAACACACATCACAATCCAGG - Intergenic
1040244829 8:45506739-45506761 GAGAACACACATCACAATCAAGG - Intergenic
1040244956 8:45508609-45508631 GAGAACACACATCACAATCAAGG - Intergenic
1040245080 8:45510478-45510500 GAGAACACACATCACAATCAAGG - Intergenic
1040245210 8:45512348-45512370 GAGAACACACATCACAATCAAGG - Intergenic
1040245380 8:45514898-45514920 GAGAACACACATCACAATCAAGG - Intergenic
1040245507 8:45516767-45516789 GAGAACACACATCACAATCAAGG - Intergenic
1040245587 8:45517961-45517983 GAGAACACACATCACAATCAAGG - Intergenic
1040245713 8:45519830-45519852 GAGAACACACATCACAATCAAGG - Intergenic
1040246007 8:45524245-45524267 GAGAACACACATCACAATCAAGG - Intergenic
1040246136 8:45526112-45526134 GAGAACACACATCACAATCAAGG - Intergenic
1040246448 8:45530529-45530551 GAGAACACACATCACAATCCAGG - Intergenic
1040246670 8:45533754-45533776 GAGAACACACATCACAATCAAGG - Intergenic
1040247076 8:45539691-45539713 GAGAACACACATCACAATCAAGG - Intergenic
1040247203 8:45541562-45541584 GAGAACACACATCACAATCAAGG - Intergenic
1040247330 8:45543432-45543454 GAGAACACACATCACAATCAAGG - Intergenic
1040247456 8:45545300-45545322 GAGAACACACATCACAATCAAGG - Intergenic
1040247578 8:45547168-45547190 GAGAACACACATCACAATCAAGG - Intergenic
1040247705 8:45549037-45549059 GAGAACACACATCACAATCAAGG - Intergenic
1040247831 8:45550906-45550928 GAGAACACACATCACAATCAAGG - Intergenic
1040247912 8:45552100-45552122 GAGAACACACATCACAATCAAGG - Intergenic
1040248037 8:45553970-45553992 GAGAACACACATCACAATCAAGG - Intergenic
1040248165 8:45555840-45555862 GAGAACACACATCACAATCAAGG - Intergenic
1040248430 8:45559749-45559771 GAGAACACACATCACAATCAAGG - Intergenic
1040248603 8:45562298-45562320 GAGAACACACATCACAATCAAGG - Intergenic
1040248729 8:45564167-45564189 GAGAACACACATCACAATCAAGG - Intergenic
1040248854 8:45566035-45566057 GAGAACACACATCACAATCAAGG - Intergenic
1040248972 8:45567904-45567926 GAGAACACACATCACAATCAAGG - Intergenic
1040249097 8:45569772-45569794 GAGAACACACATCACAATCAAGG - Intergenic
1040249226 8:45571639-45571661 GAGAACACACATCACAATCAAGG - Intergenic
1040249354 8:45573509-45573531 GAGAACACACATCACAATCCAGG - Intergenic
1040249529 8:45576058-45576080 GAGAACACACATCACAATCAAGG - Intergenic
1040249655 8:45577925-45577947 GAGAACACACATCACAATCAAGG - Intergenic
1040249921 8:45581828-45581850 GAGAACACACATCACAATCCAGG - Intergenic
1040250432 8:45589473-45589495 GAGAACACACATCACAATCAAGG - Intergenic
1040250557 8:45591341-45591363 GAGAACACACATCACAATCAAGG - Intergenic
1040250687 8:45593210-45593232 GAGAACACACATCACAATCAAGG - Intergenic
1040250812 8:45595078-45595100 GAGAACACACATCACAATCAAGG - Intergenic
1040251028 8:45598302-45598324 GAGAACACACATCACAATCAAGG - Intergenic
1040251152 8:45600170-45600192 GAGAACACACATCACAATCAAGG - Intergenic
1040251281 8:45602040-45602062 GAGAACACACATCACAATCAAGG - Intergenic
1040251408 8:45603908-45603930 GAGAACACACATCACAATCAAGG - Intergenic
1040251537 8:45605776-45605798 GAGAACACACATCACAATCAAGG - Intergenic
1040251660 8:45607646-45607668 GAGAACACACATCACAATCAAGG - Intergenic
1040252102 8:45614096-45614118 GAGAACACACATCACAATCAAGG - Intergenic
1040252414 8:45618679-45618701 GAGAACACACATCACAATCAAGG - Intergenic
1040252668 8:45622420-45622442 GAGAACACACATCACAATCAAGG - Intergenic
1040252796 8:45624287-45624309 GAGAACACACATCACAATCAAGG - Intergenic
1040252923 8:45626155-45626177 GAGAACACACATCACAATCAAGG - Intergenic
1040253234 8:45630736-45630758 GAGAACACACATCACAATCAAGG - Intergenic
1040253543 8:45635317-45635339 GAGAACACACATCACAATCAAGG - Intergenic
1040253670 8:45637187-45637209 GAGAACACACATCACAATCAAGG - Intergenic
1040253794 8:45639057-45639079 GAGAACACACATCACAATCAAGG - Intergenic
1040253926 8:45640926-45640948 GAGAACACACACCACAATCCAGG - Intergenic
1040254006 8:45642120-45642142 GAGAACACACATCACAATCAAGG - Intergenic
1040254229 8:45645344-45645366 GAGAACACACATCACAATCAAGG - Intergenic
1040254357 8:45647213-45647235 GAGAACACACATCACAATCAAGG - Intergenic
1040254485 8:45649082-45649104 GAGAACACACATCACAATCAAGG - Intergenic
1040254613 8:45650954-45650976 GAGAACACACATCACAATCAAGG - Intergenic
1040254737 8:45652822-45652844 GAGAACACACATCACAATCAAGG - Intergenic
1040254954 8:45656048-45656070 GAGAACACACATCACAATCAAGG - Intergenic
1040255079 8:45657917-45657939 GAGAACACACATCACAATCAAGG - Intergenic
1040255206 8:45659787-45659809 GAGAACACACATCACAATCAAGG - Intergenic
1040255337 8:45661657-45661679 GAGAACACACATCACAATCAAGG - Intergenic
1040255555 8:45664880-45664902 GAGAACACACATCACAATCAAGG - Intergenic
1040255683 8:45666748-45666770 GAGAACACACATCACAATCAAGG - Intergenic
1040255808 8:45668616-45668638 GAGAACACACATCACAATCAAGG - Intergenic
1040255932 8:45670485-45670507 GAGAACACACATCACAATCAAGG - Intergenic
1040256061 8:45672354-45672376 GAGAACACACATCACAATCAAGG - Intergenic
1040256284 8:45675579-45675601 GAGAACACACATCACAATCAAGG - Intergenic
1040256412 8:45677449-45677471 GAGAACACACATCACAATCAAGG - Intergenic
1040256536 8:45679318-45679340 GAGAACACACATCACAATCAAGG - Intergenic
1040256664 8:45681188-45681210 GAGAACACACATCACAATCAAGG - Intergenic
1040256880 8:45684413-45684435 GAGAACACACATCACAATCAAGG - Intergenic
1040257097 8:45687637-45687659 GAGAACACACATCACAATCAAGG - Intergenic
1040257317 8:45690862-45690884 GAGAACACACATCACAATCAAGG - Intergenic
1040257441 8:45692730-45692752 GAGAACACACATCACAATCAAGG - Intergenic
1040257789 8:45697823-45697845 GAGAACACACATCACAATCAAGG - Intergenic
1040258189 8:45703758-45703780 GAGAACACACATCACAATCAAGG - Intergenic
1040258527 8:45708680-45708702 GAGAACACACATCACAATCAAGG - Intergenic
1040258748 8:45711903-45711925 GAGAACACACATCACAATCAAGG - Intergenic
1040258962 8:45715128-45715150 GAGAACACACATCACAATCAAGG - Intergenic
1040259094 8:45716997-45717019 GAGAACACACATCACAATCAAGG - Intergenic
1040259223 8:45718865-45718887 GAGAACACACATCACAATCAAGG - Intergenic
1040259347 8:45720735-45720757 GAGAACACACATCACAATCAAGG - Intergenic
1040259562 8:45723959-45723981 GAGAACACACATCACAATCAAGG - Intergenic
1040259867 8:45728542-45728564 GAGAACACACATCACAATCAAGG - Intergenic
1040259992 8:45730411-45730433 GAGAACACACATCACAATCAAGG - Intergenic
1040260121 8:45732279-45732301 GAGAACACACATCACAATCAAGG - Intergenic
1040260245 8:45734149-45734171 GAGAACACACATCACAATCAAGG - Intergenic
1040260375 8:45736017-45736039 GAGAACACACATCACAATCAAGG - Intergenic
1040260501 8:45737885-45737907 GAGAACACACATCACAATCAAGG - Intergenic
1040260628 8:45739755-45739777 GAGAACACACATCACAATCAAGG - Intergenic
1040260974 8:45744847-45744869 GAGAACACACATCACAATCAAGG - Intergenic
1040261102 8:45746716-45746738 GAGAACACACATCACAATCAAGG - Intergenic
1040261229 8:45748584-45748606 GAGAACACACATCACAATCAAGG - Intergenic
1040261477 8:45752321-45752343 GAGAACACACATCACAATCAAGG - Intergenic
1040261604 8:45754189-45754211 GAGAACACACATCACAATCAAGG - Intergenic
1040261730 8:45756057-45756079 GAGAACACACATCACAATCAAGG - Intergenic
1040261859 8:45757925-45757947 GAGAACACACATCACAATCAAGG - Intergenic
1040261980 8:45759795-45759817 GAGAACACACATCACAATCAAGG - Intergenic
1040262105 8:45761664-45761686 GAGAACACACATCACAATCAAGG - Intergenic
1040262233 8:45763534-45763556 GAGAACACACATCACAATCAAGG - Intergenic
1040262361 8:45765402-45765424 GAGAACACACATCACAATCAAGG - Intergenic
1040262490 8:45767270-45767292 GAGAACACACATCACAATCAAGG - Intergenic
1040262614 8:45769139-45769161 GAGAACACACATCACAATCAAGG - Intergenic
1040262738 8:45771008-45771030 GAGAACACACATCACAATCAAGG - Intergenic
1040262864 8:45772877-45772899 GAGAACACACATCACAATCAAGG - Intergenic
1040262993 8:45774747-45774769 GAGAACACACATCACAATCAAGG - Intergenic
1040263119 8:45776616-45776638 GAGAACACACATCACAATCAAGG - Intergenic
1040263245 8:45778486-45778508 GAGAACACACATCACAATCAAGG - Intergenic
1040263376 8:45780354-45780376 GAGAACACACATCACAATCAAGG - Intergenic
1040263504 8:45782223-45782245 GAGAACACACATCACAATCAAGG - Intergenic
1040263630 8:45784091-45784113 GAGAACACACATCACAATCAAGG - Intergenic
1040263752 8:45785960-45785982 GAGAACACACATCACAATCAAGG - Intergenic
1040263878 8:45787828-45787850 GAGAACACACATCACAATCAAGG - Intergenic
1040264005 8:45789696-45789718 GAGAACACACATCACAATCAAGG - Intergenic
1040264131 8:45791564-45791586 GAGAACACACATCACAATCAAGG - Intergenic
1040264348 8:45794788-45794810 GAGAACACACATCACAATCAAGG - Intergenic
1040264475 8:45796657-45796679 GAGAACACACATCACAATCAAGG - Intergenic
1040264600 8:45798526-45798548 GAGAACACACATCACAATCAAGG - Intergenic
1040264726 8:45800395-45800417 GAGAACACACATCACAATCAAGG - Intergenic
1040264851 8:45802264-45802286 GAGAACACACATCACAATCAAGG - Intergenic
1040264977 8:45804132-45804154 GAGAACACACATCACAATCAAGG - Intergenic
1040265106 8:45806001-45806023 GAGAACACACATCACAATCAAGG - Intergenic
1040265361 8:45809737-45809759 GAGAACACACATCACAATCAAGG - Intergenic
1040265489 8:45811606-45811628 GAGAACACACATCACAATCAAGG - Intergenic
1040265617 8:45813475-45813497 GAGAACACACATCACAATCAAGG - Intergenic
1040265742 8:45815343-45815365 GAGAACACACATCACAATCAAGG - Intergenic
1040265866 8:45817212-45817234 GAGAACACACATCACAATCAAGG - Intergenic
1040265992 8:45819081-45819103 GAGAACACACATCACAATCAAGG - Intergenic
1040266121 8:45820952-45820974 GAGAACACACATCACAATCAAGG - Intergenic
1040266246 8:45822821-45822843 GAGAACACACATCACAATCAAGG - Intergenic
1040266371 8:45824692-45824714 GAGAACACACATCACAATCAAGG - Intergenic
1040266493 8:45826561-45826583 GAGAACACACATCACAATCAAGG - Intergenic
1040266625 8:45828429-45828451 GAGAACACACATCACAATCAAGG - Intergenic
1040266751 8:45830299-45830321 GAGAACACACATCACAATCAAGG - Intergenic
1040266873 8:45832169-45832191 GAGAACACACATCACAATCAAGG - Intergenic
1040266999 8:45834039-45834061 GAGAACACACATCACAATCAAGG - Intergenic
1040267123 8:45835908-45835930 GAGAACACACATCACAATCAAGG - Intergenic
1040267249 8:45837776-45837798 GAGAACACACATCACAATCAAGG - Intergenic
1040267373 8:45839645-45839667 GAGAACACACATCACAATCAAGG - Intergenic
1040267627 8:45843385-45843407 GAGAACACACATCACAATCAAGG - Intergenic
1040267754 8:45845252-45845274 GAGAACACACACCACAATCAAGG - Intergenic
1040267881 8:45847120-45847142 GAGAACACACATCACAATCAAGG - Intergenic
1040268011 8:45848988-45849010 GAGAACACACATCACAATCAAGG - Intergenic
1040268137 8:45850856-45850878 GAGAACACACATCACAATCAAGG - Intergenic
1040268267 8:45852724-45852746 GAGAACACACATCACAATCAAGG - Intergenic
1040268394 8:45854592-45854614 GAGAACACACATCACAATCAAGG - Intergenic
1040268613 8:45857817-45857839 GAGAACACACATCACAATCAAGG - Intergenic
1040268740 8:45859686-45859708 GAGAACACACATCACAATCAAGG - Intergenic
1040268890 8:45861893-45861915 GAGAACACACATCACAATCAAGG - Intergenic
1040269018 8:45863761-45863783 GAGAACACACATCACAATCAAGG - Intergenic
1040269149 8:45865722-45865744 GAGAACACACATCACAATCAAGG - Intergenic
1040269273 8:45867594-45867616 GAGAACACACATCACAATCAAGG - Intergenic
1040269399 8:45869463-45869485 GAGAACACACATCACAATCAAGG - Intergenic
1040269529 8:45871331-45871353 GAGAACACACATCACAATCAAGG - Intergenic
1040269779 8:45875067-45875089 GAGAACACACATCACAATCAAGG - Intergenic
1040269905 8:45876937-45876959 GAGAACACACATCACAATCAAGG - Intergenic
1040270048 8:45929031-45929053 GAGAACACACATCACAATCAAGG - Intergenic
1040270173 8:45930899-45930921 GAGAACACACATCACAATCAAGG - Intergenic
1040270292 8:45932767-45932789 GAGAACACACATCACAATCAAGG - Intergenic
1040270415 8:45934635-45934657 GAGAACACACATCACAATCAAGG - Intergenic
1040270666 8:45938373-45938395 GAGAACACACATCACAATCAAGG - Intergenic
1040270927 8:45942110-45942132 GAGAACACACATCACAATCAAGG - Intergenic
1040271058 8:45943979-45944001 GAGAACACACATCACAATCAAGG - Intergenic
1042178151 8:66058034-66058056 GAGGACACACACCACTCACGAGG - Intronic
1042178158 8:66058061-66058083 GCGAGAACACACCACCATCGAGG - Intronic
1048031992 8:130641540-130641562 GAGGACATTCACCACCTTCCTGG + Intergenic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1061439284 9:130588980-130589002 GAAGGCTCACACCAGCATCGAGG - Intronic
1061774265 9:132950184-132950206 GACAACCAACACCACCATCGAGG + Intronic
1062375512 9:136260154-136260176 GAGGACACACACGACCCCCAGGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1188262779 X:28038632-28038654 AAGGACACACAGAACCATAGTGG + Intergenic