ID: 1185619336

View in Genome Browser
Species Human (GRCh38)
Location X:1443881-1443903
Sequence GTGGACAGACACCCCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 1, 2: 3, 3: 22, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619328_1185619336 29 Left 1185619328 X:1443829-1443851 CCATTTTGGCCATCGAGGACACA 0: 1
1: 0
2: 2
3: 10
4: 81
Right 1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG 0: 1
1: 1
2: 3
3: 22
4: 162
1185619329_1185619336 20 Left 1185619329 X:1443838-1443860 CCATCGAGGACACACACCACCAT 0: 1
1: 0
2: 8
3: 47
4: 165
Right 1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG 0: 1
1: 1
2: 3
3: 22
4: 162
1185619332_1185619336 1 Left 1185619332 X:1443857-1443879 CCATCGTGGACAGACACCGCCGT 0: 1
1: 2
2: 10
3: 37
4: 83
Right 1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG 0: 1
1: 1
2: 3
3: 22
4: 162
1185619331_1185619336 4 Left 1185619331 X:1443854-1443876 CCACCATCGTGGACAGACACCGC 0: 3
1: 4
2: 25
3: 23
4: 118
Right 1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG 0: 1
1: 1
2: 3
3: 22
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619336 Original CRISPR GTGGACAGACACCCCCATCA TGG Intronic
900252507 1:1678461-1678483 GTGCACAGACACACACAGCAGGG - Intronic
901019246 1:6247682-6247704 GTGGACAGACGCCCCCCAGATGG + Exonic
901069771 1:6511334-6511356 GAGGACAGGCACCACCAACAAGG + Intronic
901219950 1:7578065-7578087 GTGCACAGTAACTCCCATCATGG - Intronic
918512957 1:185331293-185331315 GTGGACAGACACCTGCAGCGAGG + Intergenic
920088023 1:203432309-203432331 GTGGAAAGACACCCCCAGCCAGG - Intergenic
920777389 1:208953157-208953179 ATGGCCAGACACCCCAAGCAGGG + Intergenic
922202625 1:223419105-223419127 GTGCACAGACACACACATGAGGG + Intergenic
922963365 1:229666863-229666885 TTGGACAGACACCTGCAGCAGGG + Intergenic
924594745 1:245435251-245435273 GAGGACAGCCACCGCCCTCAGGG + Intronic
1065283492 10:24164752-24164774 GGGAGCAGACACCCCCCTCAGGG + Intronic
1066496669 10:35948848-35948870 GTGGAAAGGCAGCCCCAGCATGG - Intergenic
1066624344 10:37390997-37391019 GTGGAAAGGCAGCCCCAGCATGG - Intergenic
1068521771 10:58085047-58085069 GTGGACAGGCAACAGCATCAGGG - Intergenic
1071475957 10:86025122-86025144 GTGGACTGACTTCTCCATCAGGG - Intronic
1072374961 10:94804701-94804723 GTGGACAAACAGCCTCATGATGG - Intronic
1072787835 10:98296272-98296294 GAGGCCAGTCACTCCCATCATGG - Intergenic
1074920818 10:118009111-118009133 GAGGAAAGACACCCACATCCGGG - Exonic
1075655038 10:124155829-124155851 GTGTCCAGAGACCCCCACCAGGG + Intergenic
1076728074 10:132422491-132422513 GAGGACAGACACCCACACCTCGG - Intergenic
1076919339 10:133443192-133443214 GTGGACAGACAAGGCCATGACGG + Intergenic
1077383707 11:2259325-2259347 GTGGGCACATACCCCCATGAGGG - Intergenic
1084519816 11:69656317-69656339 GTGTACAGACCCACCCATCACGG - Intronic
1084519828 11:69656358-69656380 GTGTACAGACACCCCCATTGTGG - Intronic
1084519842 11:69656399-69656421 GTGTACAGACCCCCCCATCGTGG - Intronic
1085120426 11:73964174-73964196 GTGCAAAGACAGCCCCATCCTGG - Intronic
1090267311 11:125361353-125361375 GGAGACAGACATCCCCATCATGG + Intronic
1090673648 11:128969643-128969665 ATGGACAGAGCCCACCATCACGG - Exonic
1094212222 12:27904662-27904684 AAGGACAGACACCCCCAACTTGG + Intergenic
1094730041 12:33164007-33164029 GTTGACAGACACCTCAAGCAGGG + Intergenic
1096994046 12:55828074-55828096 GCGGAAAGAAACCCCCATCCCGG - Exonic
1099856983 12:88180363-88180385 CTGGGCAGACACCCCCTTCCCGG - Intronic
1102299566 12:111761212-111761234 CAGGGCAGACACCCCCATCATGG - Intronic
1102643512 12:114387732-114387754 ATGCACAGCCACCCCCACCATGG - Intronic
1103487548 12:121293601-121293623 GTGGCCAGACACCACTCTCAGGG - Intronic
1104072467 12:125357743-125357765 GGAGACAAACATCCCCATCAAGG - Intronic
1105362248 13:19731161-19731183 GTGGACTGACACCTGCTTCAGGG - Intronic
1112388587 13:98962434-98962456 GTGGACACACGACCCTATCAGGG - Intronic
1113224732 13:108147330-108147352 GTGGACAGTGACTCCAATCATGG - Intergenic
1113224751 13:108147428-108147450 GTGGACAGTGACTCCAATCATGG - Intergenic
1113519965 13:110933599-110933621 GTGGACAGGCACACTCAACACGG - Intergenic
1113982169 13:114285284-114285306 GTAGACAGACACATCCACCAAGG - Intronic
1118473450 14:66095322-66095344 GTGCTCAGACACCCCAAGCAGGG - Intergenic
1122273258 14:100577847-100577869 CGGGACAGAAGCCCCCATCAAGG - Intronic
1122342871 14:101039784-101039806 CTGGACTGAAACCACCATCAGGG + Intergenic
1123573105 15:21635729-21635751 GAGGACAGAGACACTCATCAAGG + Intergenic
1123609726 15:22078348-22078370 GAGGACAGAGACACTCATCAAGG + Intergenic
1124553996 15:30708918-30708940 GTGGGCACCCACCCCCATCTGGG + Intronic
1124677251 15:31696753-31696775 GTGGGCACCCACCCCCATCTGGG - Intronic
1127296655 15:57614631-57614653 GTGGAAAGAGCCCCCCATCCTGG + Intronic
1202981968 15_KI270727v1_random:370142-370164 GAGGACAGAGACACTCATCAAGG + Intergenic
1133857371 16:9562196-9562218 GTGGACAGACACACAGAGCAGGG + Intergenic
1134804539 16:17113441-17113463 GTGGACAAAAACCACTATCATGG - Intronic
1147507815 17:41037698-41037720 GTGGACAGAGCCACACATCAGGG - Intergenic
1148486723 17:47995461-47995483 GGGGGCAGCCGCCCCCATCATGG - Intergenic
1148496822 17:48058040-48058062 TTGGCCAGACTCCCCCATCTTGG - Intronic
1148746876 17:49923500-49923522 GGGGACCCCCACCCCCATCAAGG + Intergenic
1150432776 17:65131735-65131757 GATGACAGACCCCCCCAGCAGGG + Intergenic
1150612971 17:66748727-66748749 GTGGACAGTCACTCCCAGGAAGG + Intronic
1154158402 18:11961202-11961224 CTGGACACACACCCACTTCAGGG - Intergenic
1157148925 18:45195185-45195207 GTGGCCAGACACTCCCTTCAGGG - Intergenic
1158541826 18:58363782-58363804 GTGAACTGACACTCCTATCAAGG - Intronic
1160760522 19:781991-782013 CTCTACAGACAACCCCATCAAGG + Intergenic
1161343047 19:3753140-3753162 GTGGAGAGACAGCCGCATCTTGG + Intronic
1162854630 19:13458972-13458994 GTGCCCAGACAGCCCCACCAAGG - Intronic
1163577358 19:18118444-18118466 GCGGACAGACACCCCAGTCCAGG - Intronic
1164601326 19:29565635-29565657 GTGTACAGAGACCCCCAGGATGG + Intergenic
926697736 2:15782472-15782494 GTGGTCAGGGACCCCCCTCAGGG - Intergenic
928089100 2:28363336-28363358 GTGGCCTGAGACCCCCTTCACGG + Intergenic
931912497 2:66916668-66916690 CTGCACAGACACCACCTTCAGGG + Intergenic
934773218 2:96921221-96921243 GTGGTCAGACACCCAGCTCAGGG + Exonic
945282169 2:208046285-208046307 GTGGAAAGACACACTCACCAGGG - Intergenic
946309458 2:218874701-218874723 GGGGAATGACTCCCCCATCAAGG + Intergenic
947796061 2:232894722-232894744 GGGGACAGCCACCTCCCTCAGGG - Intronic
948545764 2:238727570-238727592 GTGGAGAGAGACTCCCAGCAAGG + Intergenic
948814395 2:240502488-240502510 GGGGACAGCCAGCCCCAGCAGGG + Intronic
1168940993 20:1711515-1711537 GGGGATAGACACCCCCACCAGGG + Intergenic
1174897622 20:54467711-54467733 GTGGACAGCCAGCTCCATGAGGG + Intergenic
1175669655 20:60890949-60890971 GGGGACAGACACCTCCTTCAGGG + Intergenic
1176915595 21:14621810-14621832 ATGGACAGACTGCCCCCTCAAGG + Intronic
1180244119 21:46534908-46534930 GAGTCCAGACAACCCCATCAGGG + Intronic
1180972865 22:19824724-19824746 GTCCACAGACACCCCACTCAAGG + Intronic
1181685875 22:24527705-24527727 GTGGCCAGGCAGCTCCATCAGGG - Intronic
1182270977 22:29153114-29153136 GTGAAAAGACACTCCCACCAGGG - Intronic
1184012368 22:41758768-41758790 GTGGACAAACAACACCCTCAAGG - Intronic
953349987 3:42208261-42208283 GTTCCCAGACACCCACATCAAGG - Intronic
954594127 3:51810908-51810930 ATGGACAGACAACCTAATCATGG + Intergenic
962790833 3:138810255-138810277 GTGTAGATACACCCCCATCAAGG + Intronic
964060627 3:152518026-152518048 GTGGACATACACACACATCCAGG - Intergenic
968869127 4:3232544-3232566 GTTGACAGAAACCACTATCAGGG + Intronic
968904296 4:3444475-3444497 GTGGACAGGGACACCCGTCAGGG - Intronic
981412301 4:144446851-144446873 GTCCACAGCCACCACCATCAAGG - Intergenic
985640012 5:1059169-1059191 GTGGACAGAGACCCCTTCCACGG - Intronic
991948918 5:71929131-71929153 GTGAAAAGACACTCCCACCAGGG + Intergenic
994561086 5:101373288-101373310 CTGGACAGAGACCCTCATAAAGG + Intergenic
1000759957 5:165210497-165210519 GTGGACAGACATACACTTCAAGG - Intergenic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1002780828 6:364583-364605 GTGGACAGACACCCATCTCGTGG + Intergenic
1006473399 6:34240585-34240607 GTGGGCAGACCCCTCCATCCTGG + Intronic
1008334262 6:50281426-50281448 CTGGCCAGACACCCACATCCTGG + Intergenic
1019445503 7:1068983-1069005 GTGGGCAGGCACACCCAGCACGG - Intronic
1019611226 7:1937612-1937634 GGGGACAGCCGCCCCCAGCAGGG + Intronic
1019615069 7:1955632-1955654 GTGGGCAGGCACACCCAGCACGG + Intronic
1022164002 7:27740244-27740266 GTGGAAAGACTCCCGGATCAAGG - Exonic
1026595036 7:71727269-71727291 CTGCACACACACCCCCACCATGG - Intergenic
1034305092 7:150040793-150040815 GTGGGGAGACACCCCCCGCAAGG - Intergenic
1034305724 7:150043317-150043339 GTGGGGAGACACCCCCCGCAAGG - Intergenic
1035211775 7:157334075-157334097 GTGGACAGACAGTACTATCATGG - Intergenic
1045238845 8:100380103-100380125 GTGGCCAGACATCTCCATTATGG + Intronic
1046630904 8:116622324-116622346 GTGGAGTGAAACCCCCACCATGG + Intergenic
1049529773 8:143148396-143148418 ATGGGCACCCACCCCCATCATGG + Intergenic
1050799955 9:9598229-9598251 GTGGACACAGTCCCACATCAGGG + Intronic
1053180018 9:35960768-35960790 GTGGGCAGCCACCTTCATCAAGG - Intergenic
1056568605 9:87796773-87796795 GTGGACAGACACAGCCCTGAGGG + Intergenic
1057563190 9:96144909-96144931 GTGGACAGACACCCCAAGACTGG - Intergenic
1061304744 9:129725748-129725770 GTGGACAGACCCCCCAACCCAGG + Intergenic
1203444806 Un_GL000219v1:45069-45091 GTGGGCGGAGACCCCCATCTCGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1187303387 X:18073376-18073398 CTAGAAAGACACCCCCAACAGGG - Intergenic
1188561166 X:31470564-31470586 GTTGACAGACACCCTCATACAGG - Intronic
1189312997 X:40033128-40033150 GTACCCAGACACCCCCACCAAGG + Intergenic
1190217788 X:48491670-48491692 GTGTACAGACACCACAATCTAGG - Intergenic
1195325547 X:103755435-103755457 GAGGGCAGGCACCCTCATCAGGG - Intergenic
1200074011 X:153542386-153542408 GTGGTCAGACTCGCCCGTCAGGG - Exonic
1200686585 Y:6264614-6264636 GTGGACAGGCCCACCCCTCAGGG - Intergenic
1200831546 Y:7691475-7691497 GTGGACAGAACCACCCCTCAGGG + Intergenic
1200954529 Y:8930416-8930438 GTGGACACACCCACCCCTCAGGG - Intergenic
1200989460 Y:9335530-9335552 GTGGACAGGCCCACCCCTCAGGG - Intergenic
1200992133 Y:9355863-9355885 GTGGACAGGCCCACCCCTCAGGG - Intergenic
1200994783 Y:9376141-9376163 GTGGACAGGCCCACCCCTCAGGG - Intronic
1200997447 Y:9396487-9396509 GTGGACAGGCCCACCCCTCAGGG - Intergenic
1200999959 Y:9465023-9465045 GTGGACAGGCCCACCCCTCAGGG - Intergenic
1201002620 Y:9485333-9485355 GTGGACAGGCCCACCCCTCAGGG - Intronic
1201005275 Y:9505617-9505639 GTGGACAGGCCCACCCCTCAGGG - Intergenic
1201007938 Y:9525946-9525968 GTGGACAGGCCCACCCCTCAGGG - Intergenic
1201010555 Y:9546137-9546159 GTGGACAGGCCCACCCCTCAGGG - Intergenic
1201766837 Y:17580205-17580227 GTGCAGAGAAACCCCCATCCTGG - Intergenic
1201834716 Y:18325780-18325802 GTGCAGAGAAACCCCCATCCTGG + Intergenic
1202232657 Y:22671811-22671833 GTGGACACACCCACCCCTCAGGG - Intergenic
1202310499 Y:23524347-23524369 GTGGACACACCCACCCCTCAGGG + Intergenic
1202560303 Y:26146247-26146269 GTGGACACACCCACCCCTCAGGG - Intergenic