ID: 1185619341

View in Genome Browser
Species Human (GRCh38)
Location X:1443900-1443922
Sequence ATGGACACACACCGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619335_1185619341 1 Left 1185619335 X:1443876-1443898 CCGTCGTGGACAGACACCCCCAT No data
Right 1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG No data
1185619332_1185619341 20 Left 1185619332 X:1443857-1443879 CCATCGTGGACAGACACCGCCGT No data
Right 1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG No data
1185619334_1185619341 4 Left 1185619334 X:1443873-1443895 CCGCCGTCGTGGACAGACACCCC No data
Right 1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG No data
1185619331_1185619341 23 Left 1185619331 X:1443854-1443876 CCACCATCGTGGACAGACACCGC No data
Right 1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619341 Original CRISPR ATGGACACACACCGCCATCT TGG Intronic