ID: 1185619344

View in Genome Browser
Species Human (GRCh38)
Location X:1443919-1443941
Sequence TTGGACAGACACCCCCGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619338_1185619344 3 Left 1185619338 X:1443893-1443915 CCCCATCATGGACACACACCGCC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG 0: 1
1: 0
2: 3
3: 23
4: 79
1185619340_1185619344 1 Left 1185619340 X:1443895-1443917 CCATCATGGACACACACCGCCAT 0: 5
1: 22
2: 28
3: 52
4: 249
Right 1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG 0: 1
1: 0
2: 3
3: 23
4: 79
1185619337_1185619344 4 Left 1185619337 X:1443892-1443914 CCCCCATCATGGACACACACCGC 0: 5
1: 14
2: 18
3: 29
4: 207
Right 1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG 0: 1
1: 0
2: 3
3: 23
4: 79
1185619335_1185619344 20 Left 1185619335 X:1443876-1443898 CCGTCGTGGACAGACACCCCCAT 0: 1
1: 4
2: 8
3: 53
4: 153
Right 1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG 0: 1
1: 0
2: 3
3: 23
4: 79
1185619334_1185619344 23 Left 1185619334 X:1443873-1443895 CCGCCGTCGTGGACAGACACCCC 0: 1
1: 0
2: 4
3: 16
4: 102
Right 1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG 0: 1
1: 0
2: 3
3: 23
4: 79
1185619339_1185619344 2 Left 1185619339 X:1443894-1443916 CCCATCATGGACACACACCGCCA 0: 1
1: 0
2: 0
3: 18
4: 162
Right 1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG 0: 1
1: 0
2: 3
3: 23
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619344 Original CRISPR TTGGACAGACACCCCCGTCT TGG Intronic
901646970 1:10722076-10722098 CTGGGCAGACACCTGCGTCTTGG + Intronic
902658629 1:17886539-17886561 TGGGAAAGAGACCCCCGGCTAGG + Intergenic
922289661 1:224199763-224199785 TTGAACAGACAGCACCGTCTGGG + Intergenic
1064357703 10:14634788-14634810 TTGGATAGAAACCTCAGTCTTGG + Intronic
1069229981 10:65996745-65996767 TTGGAGAGTCACCCCAGTGTGGG - Intronic
1077670624 11:4154105-4154127 TTAGGCAGACACCCTAGTCTAGG + Intergenic
1078450552 11:11437646-11437668 ATAGCCAGACACCTCCGTCTTGG + Intronic
1090485530 11:127108937-127108959 CAGGACAGGCACCTCCGTCTAGG - Intergenic
1094212222 12:27904662-27904684 AAGGACAGACACCCCCAACTTGG + Intergenic
1099856983 12:88180363-88180385 CTGGGCAGACACCCCCTTCCCGG - Intronic
1102976680 12:117211746-117211768 ATGGAGAGAGACACCCGTCTTGG - Exonic
1113104853 13:106760604-106760626 TTGGAGACACACCCCCGCCCAGG - Intergenic
1113345997 13:109479201-109479223 TAAGCCAGACACCCCCATCTTGG + Intergenic
1113565636 13:111318090-111318112 CTGGACTCACACCCCTGTCTAGG + Intronic
1114948233 14:27714459-27714481 TTAGACAGACACCTCCTTATTGG - Intergenic
1118331663 14:64820219-64820241 TTTGAAAGACACCCCTGCCTAGG + Intronic
1121261444 14:92569217-92569239 GTGGACAGACTCCCAGGTCTAGG + Intronic
1127958581 15:63873882-63873904 TGGTACAGACACCCCCAACTAGG + Intergenic
1131799200 15:96052584-96052606 TTAGGCAGACAGCACCGTCTTGG - Intergenic
1132988039 16:2778013-2778035 TTGCAGAGACACCCCAGGCTGGG + Intergenic
1133404712 16:5514308-5514330 TGGGACAGACAGGCTCGTCTGGG + Intergenic
1134634829 16:15784347-15784369 TGGGACAGACATCTCTGTCTAGG + Intronic
1138008096 16:53355829-53355851 TTGGACAGAGACCCCCGATAGGG + Intergenic
1140086338 16:71800498-71800520 ATGGAGAAACCCCCCCGTCTCGG + Intronic
1141789460 16:86224508-86224530 TGTGACAGACACCCCCATTTTGG - Intergenic
1144921478 17:18767870-18767892 TGGGACAGACACTACCTTCTTGG - Intronic
1148496822 17:48058040-48058062 TTGGCCAGACTCCCCCATCTTGG - Intronic
1149552463 17:57550333-57550355 CTTGACGGACACCCCCGTTTGGG + Intronic
1151960652 17:77403709-77403731 TTGGACAAACAGCACAGTCTGGG + Intronic
1163577358 19:18118444-18118466 GCGGACAGACACCCCAGTCCAGG - Intronic
1168057050 19:53869701-53869723 TTGGACAGGCTCCTCCCTCTAGG - Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
1169401216 20:5282357-5282379 TTGAACACACACCCCCCACTGGG + Intergenic
1174046807 20:47739531-47739553 TTGATCAGACACCACCTTCTTGG + Intronic
1176267430 20:64217555-64217577 TTGGACACACACGCCCGTAACGG - Intronic
979626188 4:122848052-122848074 TTGGACAGTCAGGCCAGTCTAGG - Intronic
982370366 4:154627059-154627081 TTGGACAGACACCAGAGCCTGGG + Intronic
982532217 4:156559019-156559041 TTGGAGAGACTCCCCAGTGTGGG - Intergenic
986678998 5:10216305-10216327 TTGGGCAGAACCCCCCTTCTCGG - Intergenic
1000229818 5:159305232-159305254 TTGGACAGCCATCCCCAGCTTGG + Intergenic
1001289639 5:170447632-170447654 CTGTGAAGACACCCCCGTCTTGG - Intronic
1004498277 6:16185260-16185282 TTGGTCAGACAACCCGCTCTTGG - Intergenic
1019149080 6:169992634-169992656 TGGGACAGGCACCTCAGTCTGGG - Intergenic
1035237221 7:157506366-157506388 TTGGCCAAACACCCACGTGTGGG + Intergenic
1041724557 8:61005890-61005912 TTGGTCCGACTCCCCCGCCTCGG - Intergenic
1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG + Intergenic
1062101576 9:134731319-134731341 CTGGGCAGAGACCCCCCTCTGGG - Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1195579180 X:106482268-106482290 TTGCCCAGACACCTCCATCTTGG - Intergenic
1200981059 Y:9263644-9263666 TTTCACAGACACCCTCCTCTGGG - Intergenic
1202129365 Y:21596096-21596118 TTCCACAGACACCCGCCTCTGGG + Intergenic