ID: 1185619869

View in Genome Browser
Species Human (GRCh38)
Location X:1447265-1447287
Sequence ATGGCAGTGTGTGTCGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619869_1185619872 1 Left 1185619869 X:1447265-1447287 CCATCTTCGACACACACTGCCAT No data
Right 1185619872 X:1447289-1447311 TTGGACCCATTACACCATCTTGG No data
1185619869_1185619876 20 Left 1185619869 X:1447265-1447287 CCATCTTCGACACACACTGCCAT No data
Right 1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619869 Original CRISPR ATGGCAGTGTGTGTCGAAGA TGG (reversed) Intronic