ID: 1185619870

View in Genome Browser
Species Human (GRCh38)
Location X:1447270-1447292
Sequence TTCGACACACACTGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 6, 2: 26, 3: 26, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619866_1185619870 26 Left 1185619866 X:1447221-1447243 CCTGTTATAACTAGAGGGTCTGG 0: 1
1: 1
2: 4
3: 14
4: 68
Right 1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG 0: 1
1: 6
2: 26
3: 26
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619870 Original CRISPR TTCGACACACACTGCCATCT TGG Intronic
901383915 1:8894059-8894081 TTTGACACACATGGCCACCTTGG + Intergenic
903876254 1:26475428-26475450 TTTGACACACATGGCCACCTTGG + Exonic
906137567 1:43510266-43510288 TTGGACATCCTCTGCCATCTTGG + Intergenic
910443792 1:87280187-87280209 TACGCCACACACTGCTGTCTTGG + Intergenic
914812438 1:151038749-151038771 TCCAACACACACACCCATCTTGG + Intronic
914932118 1:151944307-151944329 TTTGCCACACACTTCAATCTTGG - Intergenic
915336937 1:155149407-155149429 TTTGACACACATGGCCACCTTGG + Intergenic
915590312 1:156866751-156866773 ATCTACACACACTGCCTTCCAGG + Intronic
920572943 1:207031680-207031702 TGCCACACAAACTGCCAACTGGG + Intronic
922119843 1:222654385-222654407 TTAGACACAGACTGCAATATCGG + Exonic
922952544 1:229571084-229571106 TTTGACACACATGGCCACCTTGG + Intergenic
1063377268 10:5561810-5561832 TTGGAGTCACTCTGCCATCTTGG - Intergenic
1065578970 10:27152648-27152670 TTCTCCAGACACTGTCATCTTGG + Intronic
1067088587 10:43255318-43255340 TGCCCCACCCACTGCCATCTGGG + Intronic
1075967944 10:126628901-126628923 TTCCAAACACACTGCTATCATGG + Intronic
1081751556 11:45514725-45514747 TTTGACACACATAGCCACCTTGG + Intergenic
1085074736 11:73580791-73580813 TTTGACACACATGGCCACCTTGG + Intronic
1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG + Intronic
1097003604 12:55899387-55899409 TTTGCCCCACAATGCCATCTTGG + Intergenic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1106139004 13:26995067-26995089 TGCCACACACACAGCCACCTCGG + Intergenic
1108396847 13:49997835-49997857 TTCTACACACAGTTCCATTTTGG - Intronic
1112998524 13:105603569-105603591 TTCAACTCACATTGCCATATGGG + Intergenic
1114511289 14:23263609-23263631 TTTGACACACATGGCCACCTTGG - Intronic
1117941524 14:60971958-60971980 TTTGACACACATGGCCACCTTGG - Exonic
1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG + Intergenic
1124445858 15:29731262-29731284 TTTGACACACATGGCCACCTTGG + Intronic
1124454641 15:29829595-29829617 TTTGGCACTCCCTGCCATCTTGG - Intronic
1135858295 16:26032239-26032261 TTTGACACACATGGCCACCTTGG - Intronic
1137062329 16:35802612-35802634 TTTGACACACATGGCCACCTTGG - Intergenic
1144956276 17:19020423-19020445 TTCGCCTGACACTGCCATCCTGG + Exonic
1147753567 17:42753233-42753255 TTTGACACACATGGCCACCTTGG - Intergenic
1149784824 17:59425888-59425910 TTAGACACATGCTGTCATCTGGG - Intergenic
1150171824 17:63004404-63004426 TTTGACACACATAGCCACCTTGG - Intergenic
1150482847 17:65523936-65523958 TTTCACACAAACTGCCATCCTGG + Intergenic
1155824183 18:30418383-30418405 TTTGAGACACACTGCCATTTGGG + Intergenic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1166238340 19:41472777-41472799 TTCTACACCCCCTGCCATATTGG + Intergenic
1167172606 19:47843249-47843271 TTCCCCACACACTGGCCTCTGGG + Exonic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
925656886 2:6158798-6158820 TTCAACACACATTACGATCTCGG + Intergenic
930233981 2:48871573-48871595 TTCAACACATAAGGCCATCTGGG + Intergenic
934577283 2:95410972-95410994 TTCGACACCTTCTGCCCTCTGGG + Exonic
934639580 2:96019646-96019668 TTCGACACCTTCTGCCCTCTGGG + Intergenic
934794070 2:97085731-97085753 TTCGACACCTTCTGCCCTCTGGG - Exonic
936492082 2:112980868-112980890 TTTGACACACATGGCCACCTTGG - Intronic
936893594 2:117401156-117401178 TGTGACACACACTGTGATCTGGG + Intergenic
937922049 2:127137714-127137736 CTTGTCACACCCTGCCATCTAGG - Intergenic
937998900 2:127716404-127716426 TTCGACACACACTTTCATAACGG - Intronic
938248766 2:129797984-129798006 TTCCAGACACACTGAGATCTGGG - Intergenic
945561469 2:211345950-211345972 GTCCACACAGACTGCCATCATGG + Intergenic
948931070 2:241132711-241132733 TTCCACACACACTGACTGCTGGG - Intronic
948996498 2:241582883-241582905 TTCCACACACCCTTCCAGCTGGG + Intergenic
1181788170 22:25242684-25242706 TTGGACAGAAACTGCTATCTCGG - Intergenic
1182741333 22:32570153-32570175 CTCCACACACACTGCCTTCTAGG + Intronic
950073969 3:10174077-10174099 ATCCACACACACTCCCATCTTGG - Intronic
950778962 3:15374767-15374789 TTTGACACACATGGCCACCTTGG - Intergenic
951790170 3:26472995-26473017 TTCAACACACACTGTGAGCTGGG - Intergenic
960593906 3:119391063-119391085 TCCAACCCACACTGCCATCTTGG - Intronic
964601543 3:158506336-158506358 TGTGACACATACTCCCATCTCGG - Intronic
967449240 3:189604254-189604276 TTCCACATACCCTGCAATCTAGG - Intergenic
969590304 4:8118229-8118251 TTGCACACTGACTGCCATCTGGG + Intronic
982165996 4:152614107-152614129 CTCACCACACACTGCCATGTCGG - Intergenic
982448220 4:155519995-155520017 TTGCACAAACAGTGCCATCTAGG - Intergenic
985656746 5:1135847-1135869 TTTGACAAACAGTGCCAGCTTGG + Intergenic
987571112 5:19660696-19660718 TTCTACAGACTCTGCCTTCTTGG - Intronic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
992101367 5:73410702-73410724 TTTGACACACATGGCCACCTTGG + Intergenic
992381455 5:76241721-76241743 TTTGACACACATGGCCACCTTGG - Intronic
1007407469 6:41643291-41643313 CTTGACACACTCAGCCATCTGGG + Intronic
1010727702 6:79354157-79354179 TTTGACACACATGGCCACCTTGG - Intergenic
1011221768 6:85062109-85062131 TGCGACACACAAAGCCATTTTGG - Intergenic
1012914587 6:105155890-105155912 TTGGCCACACATTGCCATCATGG - Intergenic
1013622026 6:111899326-111899348 TTCTACAAACACTGCCATTTCGG + Intergenic
1014434772 6:121409088-121409110 TTTGACACACATGGCCAGCTTGG + Intergenic
1015711469 6:136146083-136146105 TTGGTCACTCACTGCCATCAGGG + Intronic
1018451326 6:163910888-163910910 TTCGTCTCACTCTGCCATCCAGG + Intergenic
1027982540 7:85244379-85244401 TTCCACCAACACTGCCATATTGG + Intergenic
1029946084 7:104534401-104534423 TTCTACCCACACTTCCATCTCGG + Intronic
1035673311 8:1436650-1436672 CTCTACACACACTGCAAACTTGG - Intergenic
1042279116 8:67036085-67036107 TTCCACCCACACTGTCCTCTGGG - Intronic
1043252926 8:78098456-78098478 TTGGACCCTCACTGACATCTAGG + Intergenic
1044824658 8:96184534-96184556 TTGGACACACACTGAGTTCTAGG - Intergenic
1047378271 8:124326503-124326525 TTAGAACCACACTGCCTTCTCGG + Intronic
1050406323 9:5312182-5312204 TTTGACACACATGGCCACCTTGG + Intergenic
1052956888 9:34259562-34259584 TTACACACAACCTGCCATCTGGG + Intronic
1053037281 9:34836015-34836037 TTCGCCGCACACTTCCCTCTGGG + Intergenic
1054813304 9:69451814-69451836 TTGTACAAACACTGCAATCTAGG - Intronic
1055890306 9:81116936-81116958 TTCAACACAGCCTGCCATCTGGG - Intergenic
1056180665 9:84079297-84079319 TTTGACACACATGGCCACCTTGG + Intergenic
1057776890 9:98018680-98018702 TTCCACACTCACTGCAATCTTGG - Intergenic
1058952182 9:109914219-109914241 TGAGGCACAAACTGCCATCTTGG - Intronic
1060996277 9:127876350-127876372 TTCCATCCTCACTGCCATCTTGG + Intronic
1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG + Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1187043408 X:15621076-15621098 TTCGACAGAATCTGCCTTCTTGG - Intergenic
1187047018 X:15656720-15656742 TTCCACATGCACTGCCATATTGG - Intronic
1187938005 X:24354518-24354540 TTTGACACACATGGCCACCTTGG + Intergenic
1190722071 X:53157473-53157495 CTTGACACACTCTGCAATCTTGG + Intergenic
1197694358 X:129535028-129535050 TTCGGCACACAATGCCCTCCAGG - Intergenic
1199999595 X:153051854-153051876 TTTGACACACATGGCCACCTTGG - Intergenic
1201188014 Y:11422490-11422512 TCCTACACACACTTCTATCTAGG - Intergenic