ID: 1185619871

View in Genome Browser
Species Human (GRCh38)
Location X:1447284-1447306
Sequence ATGGTGTAATGGGTCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619871_1185619876 1 Left 1185619871 X:1447284-1447306 CCATCTTGGACCCATTACACCAT No data
Right 1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG No data
1185619871_1185619879 20 Left 1185619871 X:1447284-1447306 CCATCTTGGACCCATTACACCAT No data
Right 1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619871 Original CRISPR ATGGTGTAATGGGTCCAAGA TGG (reversed) Intronic