ID: 1185619872

View in Genome Browser
Species Human (GRCh38)
Location X:1447289-1447311
Sequence TTGGACCCATTACACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 2, 2: 0, 3: 10, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619869_1185619872 1 Left 1185619869 X:1447265-1447287 CCATCTTCGACACACACTGCCAT 0: 1
1: 5
2: 38
3: 70
4: 247
Right 1185619872 X:1447289-1447311 TTGGACCCATTACACCATCTTGG 0: 1
1: 2
2: 0
3: 10
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619872 Original CRISPR TTGGACCCATTACACCATCT TGG Intronic
904009365 1:27381068-27381090 TTCCACCCCTTACACCTTCTGGG - Intronic
906640095 1:47436704-47436726 TTGGGCCCATTTCAGCCTCTGGG - Exonic
907992963 1:59600679-59600701 TTATACACATTACCCCATCTAGG + Intronic
920790063 1:209081615-209081637 TTGGACAGATTACTCCATCAGGG - Intergenic
922024505 1:221738216-221738238 AGTGACCCATTACTCCATCTTGG + Intronic
924033293 1:239908960-239908982 TTGGACCCCATACAACATCATGG + Exonic
1064006259 10:11701728-11701750 TGGGAACCATTACACCATCCTGG + Intergenic
1068847106 10:61689562-61689584 TTTGATCCATTACAACATCCAGG + Intronic
1070415847 10:76188544-76188566 TTAGACACATTCCACCATCTGGG - Intronic
1072640740 10:97209369-97209391 TTGGACCCCTTCCACCATAGAGG - Intronic
1076582595 10:131522351-131522373 TTGGAACCAGTGCACCTTCTGGG - Intergenic
1077918448 11:6625882-6625904 GTGGACCCAAGACCCCATCTTGG - Intronic
1088771978 11:113044210-113044232 TTGGACCCATAACTTCTTCTGGG + Intronic
1093650432 12:21637769-21637791 TTGGACCAGTTACACTATCTGGG + Intronic
1093712236 12:22340248-22340270 TTGGCCCCATGGCAGCATCTAGG - Intronic
1093712932 12:22348288-22348310 TTTGCCCCATGACAGCATCTAGG - Intronic
1096770015 12:53929194-53929216 GAAGACCCATTTCACCATCTTGG - Intergenic
1111337113 13:86838970-86838992 TTGGAGCCCTTACTCCATCCAGG - Intergenic
1126846626 15:52766380-52766402 TTGCCCCCATTTCACCATCCTGG - Intronic
1127145613 15:56019946-56019968 TTGTACCCATTCCCTCATCTAGG + Intergenic
1128875582 15:71198605-71198627 TCTGACCCATAACACCCTCTAGG - Intronic
1129552562 15:76468886-76468908 TTGCACTCTTTTCACCATCTGGG + Intronic
1133586657 16:7202354-7202376 TTGGACCCATTACGCCCTGTGGG + Intronic
1138487863 16:57358294-57358316 ATGGACCCATTGACCCATCTGGG - Intergenic
1143961704 17:10726674-10726696 TTGGACCCAATGGACCATCCAGG + Intronic
1145801849 17:27692134-27692156 TTGTACCCTTTTCACCATCAGGG + Intergenic
1148909491 17:50933147-50933169 TTGCACTCATTACACCTTCATGG - Intergenic
1152506317 17:80751278-80751300 TTTGCCCCATTATCCCATCTGGG - Intronic
1153157277 18:2163788-2163810 TTGTAGCCATTTCACCCTCTAGG - Intergenic
1156920257 18:42513804-42513826 TTGGAGCCATGCCACCATTTTGG + Intergenic
928199712 2:29239823-29239845 TTTGTCCCATTGCAGCATCTCGG - Exonic
929009116 2:37423692-37423714 TTGGGCCGATTTCACCATCATGG + Intergenic
932117423 2:69065856-69065878 TTGGAGCCATAAGGCCATCTGGG + Intronic
942577299 2:177377706-177377728 TTGCACACATAACCCCATCTGGG + Intronic
947324042 2:228955385-228955407 CTGGGCCCATTACATCATTTAGG + Intronic
949079395 2:242084762-242084784 TTGTACCCATGGCACCATCGTGG + Intergenic
949079404 2:242084833-242084855 TTGTACCCATGACACCGTCGTGG + Intergenic
949079413 2:242084904-242084926 TTGTACCCATGACACCGTCGTGG + Intergenic
949079432 2:242085046-242085068 TTGTACCCATGACACCGTCGTGG + Intergenic
949079441 2:242085117-242085139 TTGTACCCATGACACCGTCGTGG + Intergenic
949079460 2:242085259-242085281 TTGTACCCATGACACCGTCGTGG + Intergenic
949079479 2:242085401-242085423 TTGTACCCATGACACCGTCGTGG + Intergenic
1185373177 22:50470165-50470187 TTGGCCCCAAACCACCATCTGGG + Intronic
950337629 3:12210471-12210493 TTGGAGCCATTAGGCCAGCTGGG - Intergenic
952232014 3:31441985-31442007 TTGGACCCAATACTTCATCTAGG - Intergenic
964467656 3:157014945-157014967 TGGTCCCCATTACTCCATCTTGG - Intronic
964954895 3:162341572-162341594 TTGAACCCATTAAATCATTTTGG - Intergenic
965789395 3:172371699-172371721 TTGGGCGCATTGCCCCATCTTGG + Intronic
972111161 4:35561121-35561143 TTGGACTTATTATACAATCTAGG - Intergenic
975065053 4:70050911-70050933 TTGTACACATTACAGCATCAGGG - Intronic
980452706 4:132996271-132996293 TTGAACCCATGAAACCATGTTGG - Intergenic
981156911 4:141448424-141448446 CTGGCTCCATTCCACCATCTAGG - Intergenic
994813180 5:104548807-104548829 TTGGATCCCTTAAACTATCTGGG + Intergenic
996011814 5:118489150-118489172 TTTAACCCATTACACTATCTTGG - Intergenic
997102561 5:130985097-130985119 TTTGACCCTTTACAACATCTTGG - Intergenic
997983441 5:138485276-138485298 TTGGACCCATCAATCAATCTGGG - Intergenic
998971230 5:147594707-147594729 TTTAACCAGTTACACCATCTAGG + Intronic
1000753563 5:165128294-165128316 TTAGAACCATTACTCCATCTTGG - Intergenic
1002067130 5:176657466-176657488 TTGGACCCATTTCAGAGTCTGGG - Intronic
1005860531 6:29896667-29896689 TGGGATCCACTACCCCATCTCGG + Intergenic
1007419875 6:41713001-41713023 TTGGACCTATTACGTAATCTGGG + Intronic
1009412024 6:63377280-63377302 TTAGACCTCTTACACCTTCTGGG - Intergenic
1011707638 6:90018548-90018570 TAGAACCTATTACTCCATCTTGG + Intronic
1012345651 6:98182314-98182336 GTGGACACATTACACTATATAGG - Intergenic
1013586326 6:111582232-111582254 TTTGACCCATGTCACCACCTGGG + Intronic
1028764730 7:94540638-94540660 TTGGATCATTTACACTATCTTGG - Intronic
1030373374 7:108726332-108726354 TTTGGCCCATTACTTCATCTTGG + Intergenic
1042065406 8:64869536-64869558 TTGGACACATAACTCCACCTGGG + Intergenic
1046069090 8:109228806-109228828 TTTGGCCCATTACTTCATCTGGG + Intergenic
1057059706 9:91992748-91992770 TGACACCCATTACACCATCTGGG - Intergenic
1060568292 9:124613883-124613905 TGGTCCCCATTACTCCATCTTGG - Intronic
1061887062 9:133596462-133596484 TGGGCCCCATTACCCCATCTTGG - Intergenic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619872 X:1447289-1447311 TTGGACCCATTACACCATCTTGG + Intronic
1185619956 X:1447876-1447898 TTGGACCCATAACACCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185620025 X:1448350-1448372 TTGGACCCATAACACCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1190582926 X:51905946-51905968 TTGGGCCCATTACATCATGGAGG + Intergenic
1195026013 X:100878484-100878506 TTCAACTCATTACATCATCTTGG - Intergenic
1199838780 X:151622266-151622288 TTGGAGCCATTAAAATATCTGGG + Intronic
1201354484 Y:13082842-13082864 TTGCACCCAGTCCACCAGCTGGG + Intergenic