ID: 1185619874

View in Genome Browser
Species Human (GRCh38)
Location X:1447295-1447317
Sequence GTGTGTCCAAGATGGTGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619874_1185619882 25 Left 1185619874 X:1447295-1447317 CCATTACACCATCTTGGACACAC No data
Right 1185619882 X:1447343-1447365 ATCTTGGACACACAACATCTTGG No data
1185619874_1185619876 -10 Left 1185619874 X:1447295-1447317 CCATTACACCATCTTGGACACAC No data
Right 1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG No data
1185619874_1185619879 9 Left 1185619874 X:1447295-1447317 CCATTACACCATCTTGGACACAC No data
Right 1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619874 Original CRISPR GTGTGTCCAAGATGGTGTAA TGG (reversed) Intronic