ID: 1185619876

View in Genome Browser
Species Human (GRCh38)
Location X:1447308-1447330
Sequence TTGGACACACACCGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619873_1185619876 -9 Left 1185619873 X:1447294-1447316 CCCATTACACCATCTTGGACACA No data
Right 1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG No data
1185619871_1185619876 1 Left 1185619871 X:1447284-1447306 CCATCTTGGACCCATTACACCAT No data
Right 1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG No data
1185619869_1185619876 20 Left 1185619869 X:1447265-1447287 CCATCTTCGACACACACTGCCAT No data
Right 1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG No data
1185619874_1185619876 -10 Left 1185619874 X:1447295-1447317 CCATTACACCATCTTGGACACAC No data
Right 1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619876 Original CRISPR TTGGACACACACCGCCATCT TGG Intronic