ID: 1185619884

View in Genome Browser
Species Human (GRCh38)
Location X:1447362-1447384
Sequence TTGGACACACATGGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 2, 2: 46, 3: 43, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619877_1185619884 20 Left 1185619877 X:1447319-1447341 CCGCCATCTTGGATAAGCACCAC 0: 9
1: 4
2: 5
3: 28
4: 157
Right 1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG 0: 1
1: 2
2: 46
3: 43
4: 155
1185619881_1185619884 -2 Left 1185619881 X:1447341-1447363 CCATCTTGGACACACAACATCTT 0: 3
1: 8
2: 7
3: 23
4: 195
Right 1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG 0: 1
1: 2
2: 46
3: 43
4: 155
1185619878_1185619884 17 Left 1185619878 X:1447322-1447344 CCATCTTGGATAAGCACCACCAT 0: 16
1: 21
2: 42
3: 78
4: 178
Right 1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG 0: 1
1: 2
2: 46
3: 43
4: 155
1185619880_1185619884 1 Left 1185619880 X:1447338-1447360 CCACCATCTTGGACACACAACAT 0: 3
1: 10
2: 7
3: 27
4: 183
Right 1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG 0: 1
1: 2
2: 46
3: 43
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619884 Original CRISPR TTGGACACACATGGCCATCT TGG Intronic
900148960 1:1169981-1170003 TTGGACACACCTGGAGAGCTCGG + Intergenic
901383915 1:8894059-8894081 TTTGACACACATGGCCACCTTGG + Intergenic
903876254 1:26475428-26475450 TTTGACACACATGGCCACCTTGG + Exonic
905451340 1:38058771-38058793 TTGGACACACAAGGACACCTTGG - Intergenic
912389308 1:109291104-109291126 CCGGACACACGTGGCCACCTTGG - Intergenic
915336937 1:155149407-155149429 TTTGACACACATGGCCACCTTGG + Intergenic
918082177 1:181216151-181216173 GTGGAAAAACATGGCCATCAAGG - Intergenic
920271240 1:204765791-204765813 CTGGACCTGCATGGCCATCTTGG + Intergenic
920490855 1:206413843-206413865 TGGTACACACAGGACCATCTGGG + Intronic
922952544 1:229571084-229571106 TTTGACACACATGGCCACCTTGG + Intergenic
1063685486 10:8233442-8233464 CTGGGCACACATAGCCATCTAGG + Intergenic
1066157277 10:32691456-32691478 CTGGTCACACATTGCTATCTTGG + Intronic
1072265337 10:93721773-93721795 CTGGCCAAACATGGCCATCTTGG + Intergenic
1072265505 10:93722951-93722973 CTGGTCAAACATGGCCATCTTGG - Intergenic
1073583401 10:104687189-104687211 TTGGAAAGACAAGGCCACCTTGG - Intronic
1075547445 10:123365694-123365716 TTGGAGACATTTGGCCAACTGGG - Intergenic
1078693898 11:13610120-13610142 TTTGAGACACATGGCCACCTTGG - Intergenic
1078909824 11:15720532-15720554 TTGGACTCACATGGAGTTCTGGG - Intergenic
1081751556 11:45514725-45514747 TTTGACACACATAGCCACCTTGG + Intergenic
1082962185 11:58928878-58928900 TTTGAGACAGATGGCCCTCTTGG - Intronic
1083007300 11:59358927-59358949 GTGGTCAAACATGCCCATCTTGG + Intergenic
1084704604 11:70808786-70808808 TCGGACACCCATGGCCTTCCTGG - Intronic
1085074736 11:73580791-73580813 TTTGACACACATGGCCACCTTGG + Intronic
1088220182 11:107562443-107562465 TTGGCCAAACATGTCCATTTTGG - Intronic
1088522704 11:110716333-110716355 TTGCAAACTGATGGCCATCTGGG + Intergenic
1094366545 12:29688912-29688934 TTGGTCACACAGGGCCACCAGGG - Intronic
1095633719 12:44406921-44406943 CTGGACACAGAGGGCCCTCTAGG - Intergenic
1098979110 12:76935937-76935959 TTGGCCAGACAAGACCATCTAGG - Intergenic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1104345445 12:127992410-127992432 TTACACACACATGGACATGTTGG - Intergenic
1107861796 13:44667941-44667963 ATGGACACCCATGGACATCCAGG - Intergenic
1111075987 13:83236189-83236211 CTGGACACACTTGGGCAACTTGG + Intergenic
1111552505 13:89833347-89833369 ATGGACTCACTTGGCCATCAGGG - Intergenic
1114206943 14:20581029-20581051 TGGGGCACACATGTCCATTTTGG + Intergenic
1114511289 14:23263609-23263631 TTTGACACACATGGCCACCTTGG - Intronic
1114756551 14:25266767-25266789 TCTGACACACATGGCCACCTTGG - Intergenic
1115883665 14:37947604-37947626 TTGGCCACACATGTCCTTTTTGG - Intronic
1117413390 14:55471003-55471025 TTGGACACACAGACCAATCTTGG + Intergenic
1117941524 14:60971958-60971980 TTTGACACACATGGCCACCTTGG - Exonic
1119373566 14:74168859-74168881 TTTGAGACACCTGGCCATCATGG + Intronic
1119706861 14:76788477-76788499 TTGGAGGCACAGGGCCAGCTGGG + Exonic
1119750273 14:77072361-77072383 TGGGCCACACTTGGCAATCTAGG - Intergenic
1120132416 14:80823064-80823086 GTTGACACACATGGCCACCTTGG + Intronic
1124445858 15:29731262-29731284 TTTGACACACATGGCCACCTTGG + Intronic
1126154836 15:45556210-45556232 TTTGATACACATGGCCACCTTGG + Intergenic
1128233047 15:66048723-66048745 GTGGACTCACTTGCCCATCTGGG - Intronic
1128507133 15:68281211-68281233 CTTGAGACACATGGCCATATAGG + Intronic
1129419937 15:75416640-75416662 TTTAACACACATGGCCACCTTGG + Intronic
1132179220 15:99739191-99739213 TTGGATACTGACGGCCATCTGGG - Intergenic
1135858295 16:26032239-26032261 TTTGACACACATGGCCACCTTGG - Intronic
1137062329 16:35802612-35802634 TTTGACACACATGGCCACCTTGG - Intergenic
1141550773 16:84805350-84805372 TAGGGCACACATGGTCATCCAGG - Intergenic
1144488845 17:15690298-15690320 TGGTACACACATGGCTATATTGG - Intergenic
1144638992 17:16927296-16927318 ATGGGCAGACATTGCCATCTTGG + Intergenic
1144912173 17:18692002-18692024 TGGTACACACATGGCTATATTGG + Intergenic
1145168789 17:20637137-20637159 TTGGAGCCACCTGGCCCTCTTGG + Intergenic
1145236382 17:21211081-21211103 TGAGACACACTTGCCCATCTAGG - Intronic
1147753567 17:42753233-42753255 TTTGACACACATGGCCACCTTGG - Intergenic
1148460221 17:47835535-47835557 GTGGGGACACATGGCCTTCTGGG - Intronic
1148857650 17:50587533-50587555 TTGGACAGACCTGGCTATCTGGG + Intronic
1149896830 17:60434871-60434893 TTTGATACACATGGCCACCTTGG - Intergenic
1150171824 17:63004404-63004426 TTTGACACACATAGCCACCTTGG - Intergenic
1150870120 17:68898489-68898511 TTGGATTCAAATTGCCATCTGGG - Intronic
1153837498 18:8977094-8977116 TTGGCCACACCCGGCCACCTTGG - Intergenic
1154352799 18:13600619-13600641 TTGGTCACACATGGTCTTCTTGG - Intronic
1156009186 18:32476265-32476287 GTTGACACACATAGCCACCTTGG - Intergenic
1160802878 19:978527-978549 TTGGCCACACAGGGCCAGCCGGG + Intergenic
1161013579 19:1971667-1971689 CAGGACCCACATAGCCATCTGGG - Intronic
1161312976 19:3604861-3604883 TTGGACCCACAGGGCCCTTTTGG + Intronic
1161316105 19:3618393-3618415 TTGCACACACATGGTCACCGGGG - Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1161794518 19:6378725-6378747 TTGGATGCTCATGGCCAGCTGGG - Intronic
1163291230 19:16380754-16380776 TTGCACAGACATGGCCGTTTAGG + Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
925918870 2:8625829-8625851 TGGGTCACACGTGGACATCTGGG - Intergenic
926320017 2:11743185-11743207 CTGGACACACAGGAGCATCTTGG - Intronic
927588434 2:24331553-24331575 TTTAACACACATGGCCACCTTGG + Intronic
928048180 2:27960328-27960350 TTGCACACAAAGGGCAATCTTGG - Intronic
928728831 2:34206895-34206917 ATGCACACACATGGGCATATTGG - Intergenic
930186173 2:48414220-48414242 TTGAACCCACATGAACATCTGGG - Intergenic
930233981 2:48871573-48871595 TTCAACACATAAGGCCATCTGGG + Intergenic
930748846 2:54912802-54912824 TTGGTCACTGATGGGCATCTTGG + Intronic
932117423 2:69065856-69065878 TTGGAGCCATAAGGCCATCTGGG + Intronic
935168454 2:100590445-100590467 TTTGACACACATGACCACCTTGG - Intergenic
936492082 2:112980868-112980890 TTTGACACACATGGCCACCTTGG - Intronic
936882419 2:117269962-117269984 TTGAACACAAATCCCCATCTTGG + Intergenic
937590261 2:123605030-123605052 GTGGACACACATGGGCAGATAGG - Intergenic
937738368 2:125318943-125318965 CTGGACCCACAGGGCCAGCTTGG + Intergenic
938758816 2:134405209-134405231 TTAGACAAACTTGGACATCTTGG - Intronic
942544849 2:177053008-177053030 TTGTACTCACATGGTCATTTTGG + Intergenic
946071962 2:217041760-217041782 TTGGAAACACATGGGCAATTGGG - Intergenic
946245406 2:218384433-218384455 TTGGAGAAACATGGCCAGCAGGG - Intronic
946998438 2:225423396-225423418 TTTAACACAATTGGCCATCTTGG + Intronic
947434239 2:230059182-230059204 GAGGACACCCAGGGCCATCTGGG + Exonic
949079772 2:242087968-242087990 CTGGACGCACCTGGCCTTCTCGG + Intergenic
1169134041 20:3185650-3185672 AAGGATACACAAGGCCATCTAGG + Intergenic
1174775005 20:53335297-53335319 TTGGACAAAGATGGTCATCATGG + Intronic
1180720824 22:17907157-17907179 AGGGAGACACAAGGCCATCTCGG + Intronic
1181789192 22:25250247-25250269 TTGGAGACAAATGGCCATCAAGG - Intergenic
1183374854 22:37457264-37457286 TTTAACAAACATGACCATCTGGG - Intergenic
1184005915 22:41708939-41708961 TTTGACACACGTGGCCACTTTGG - Intronic
1184391139 22:44204356-44204378 TTGGACGCACATGGCAGCCTTGG + Intronic
1184998148 22:48225614-48225636 ATAAACACACGTGGCCATCTTGG + Intergenic
1185315055 22:50175345-50175367 TTGGCCACACATGCCCAGCAAGG + Intronic
949765951 3:7525749-7525771 TTGGATACACATGGACATAAAGG - Intronic
949771824 3:7587544-7587566 TAGGGCACACAGGGCCTTCTGGG - Intronic
950778962 3:15374767-15374789 TTTGACACACATGGCCACCTTGG - Intergenic
953192217 3:40698771-40698793 TTTGACACAGATGGTCACCTTGG - Intergenic
953978362 3:47399723-47399745 AAGCTCACACATGGCCATCTGGG + Intronic
954833808 3:53446887-53446909 TTGGAGAAACATGGCCAAATAGG - Intergenic
955080060 3:55650019-55650041 TTGGAGGCACATGGCCAGCAAGG - Intronic
961958207 3:130826185-130826207 CTGGAAACAAATGGACATCTCGG - Intergenic
963398894 3:144771472-144771494 TTTGACACACATGGGCATGAAGG - Intergenic
965658747 3:171018415-171018437 TGGGAGACACAAGGCCATCCTGG - Intronic
968433096 4:570348-570370 ATGCACACACATGGCCTCCTGGG - Intergenic
968669791 4:1843005-1843027 TGCGACACACATGGCCTTTTAGG - Intronic
969471754 4:7393185-7393207 TTGGACATTCCTGGCCGTCTGGG + Intronic
971861695 4:32115373-32115395 TTGGACACAAATGAGCATATTGG - Intergenic
977657347 4:99537058-99537080 TTTGACCCAGATGGCCTTCTTGG + Intronic
982448220 4:155519995-155520017 TTGCACAAACAGTGCCATCTAGG - Intergenic
987821271 5:22970039-22970061 TTGGTCACAGATCCCCATCTTGG + Intergenic
988082497 5:26431617-26431639 TTGCAGACATATTGCCATCTTGG - Intergenic
990355907 5:54965918-54965940 TTGGATTCACATGGCAATCCTGG - Intergenic
992101367 5:73410702-73410724 TTTGACACACATGGCCACCTTGG + Intergenic
992381455 5:76241721-76241743 TTTGACACACATGGCCACCTTGG - Intronic
994999740 5:107112185-107112207 TTGAACACATATTGCAATCTAGG - Intergenic
995819840 5:116217731-116217753 TTTGACACATATGGCCACCTTGG - Intronic
997353864 5:133249776-133249798 TTGGACTCACATAGCCTTTTGGG - Intronic
998927302 5:147140793-147140815 TTTGAGACAGATGGCCCTCTAGG + Intergenic
1000015228 5:157269808-157269830 TTGTACAGACAAGGCCATCCAGG - Intronic
1002261161 5:177994971-177994993 CTGGACACACACGACCACCTGGG + Intronic
1002438671 5:179251727-179251749 TTGTCCACAAATGGCCATCGAGG + Intronic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1005484717 6:26288961-26288983 TTGGACGCATATGGCCAACCAGG - Intergenic
1006713731 6:36099687-36099709 TAAGACACACGTGGGCATCTGGG - Intronic
1007200344 6:40102770-40102792 GTGAACACACAGGGCCTTCTAGG + Intergenic
1010727702 6:79354157-79354179 TTTGACACACATGGCCACCTTGG - Intergenic
1012914587 6:105155890-105155912 TTGGCCACACATTGCCATCATGG - Intergenic
1013310953 6:108893417-108893439 TTGGGCACATCTGGCCAGCTGGG + Intronic
1014434772 6:121409088-121409110 TTTGACACACATGGCCAGCTTGG + Intergenic
1017752554 6:157501957-157501979 TTGACCACACATGGCCACCGTGG + Intronic
1018013049 6:159689168-159689190 TTGCACTCACATGACCAACTTGG + Intronic
1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG + Intergenic
1022842276 7:34176085-34176107 ATGGACACACATAGACATCAGGG - Intergenic
1023101400 7:36721971-36721993 GTGCCCACACATGGCTATCTTGG - Intronic
1023625787 7:42113898-42113920 TTTGATACACATGTCCACCTTGG + Intronic
1030641385 7:112010461-112010483 TGTGACACACATAGCCACCTGGG - Intronic
1031350237 7:120722212-120722234 TTGGAAGCACAGGGCCAGCTTGG - Intronic
1031453954 7:121956776-121956798 TTTGACATACATGGCCACCTTGG - Intronic
1031609084 7:123803954-123803976 TTGAACTCACATGGCATTCTGGG + Intergenic
1032233487 7:130098533-130098555 TTGTACACACATGGCCAAGCAGG + Intronic
1032690072 7:134276902-134276924 CTGGACAGACATGGTCCTCTTGG - Intergenic
1034576720 7:152006135-152006157 TTGGACACACATGCCTCCCTGGG - Intronic
1035537821 8:406253-406275 CTGGACCCACCTGGCCTTCTCGG + Intergenic
1040116521 8:43627129-43627151 TTGGAAACAAATGGACATTTGGG + Intergenic
1041506447 8:58603739-58603761 TTAAAAACCCATGGCCATCTGGG + Intronic
1042182303 8:66103370-66103392 TTGGAAACACAAGGTCATCCTGG - Intergenic
1043474110 8:80589819-80589841 CTGGACACACTTGGTCTTCTAGG - Intergenic
1044036625 8:87311893-87311915 TTGGACACTCATGGACATAAAGG + Intronic
1044792054 8:95857826-95857848 TTGGGCACTCATGGTCAACTGGG + Intergenic
1046734709 8:117764823-117764845 TTGGATTCACATGTCCATCAAGG + Intergenic
1047507459 8:125491217-125491239 TTATCCACACATGGGCATCTGGG - Intergenic
1049428247 8:142547109-142547131 TGGCACAGACATGGCCTTCTGGG - Intergenic
1050406323 9:5312182-5312204 TTTGACACACATGGCCACCTTGG + Intergenic
1051295362 9:15589184-15589206 ATTGACACACATAGCCACCTTGG + Intronic
1053290356 9:36875667-36875689 TTGGACCCACCTGGATATCTAGG - Intronic
1053400870 9:37820684-37820706 TTGCTCCCACTTGGCCATCTGGG - Intronic
1054744376 9:68839867-68839889 GAGTACACACTTGGCCATCTGGG - Intronic
1056180665 9:84079297-84079319 TTTGACACACATGGCCACCTTGG + Intergenic
1057247808 9:93472511-93472533 TTGGACACACAAGGCCAGTTTGG + Intronic
1058683007 9:107456594-107456616 TTTGACACACTTGGCCACCTTGG - Intergenic
1059876465 9:118640957-118640979 TTGGAGAGACAAGGCCAACTTGG + Intergenic
1061572451 9:131486107-131486129 TTGCAAACACATGGCCATCCAGG - Exonic
1203775386 EBV:70170-70192 CTGGACACACATGGCACTCATGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1187116457 X:16357062-16357084 TTTGCCCCATATGGCCATCTAGG - Intergenic
1187938005 X:24354518-24354540 TTTGACACACATGGCCACCTTGG + Intergenic
1188103579 X:26120940-26120962 TTGGAAACACATGCCCAGGTGGG - Intergenic
1189249174 X:39586787-39586809 TGGGACAGACATGGCAACCTTGG - Intergenic
1195506537 X:105664610-105664632 TTGAACTCACAGGGGCATCTGGG - Intronic
1199212153 X:145225364-145225386 TTAGAAACACATGGCCATATGGG - Intergenic
1199326477 X:146504262-146504284 TTGCACACCTATGGCCATATGGG + Intergenic
1199999595 X:153051854-153051876 TTTGACACACATGGCCACCTTGG - Intergenic