ID: 1185619897

View in Genome Browser
Species Human (GRCh38)
Location X:1447454-1447476
Sequence TTGGACACACACGGCCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 2, 2: 26, 3: 23, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619892_1185619897 1 Left 1185619892 X:1447430-1447452 CCACCATCTTGGACACACACCAT 0: 10
1: 8
2: 18
3: 47
4: 190
Right 1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG 0: 1
1: 2
2: 26
3: 23
4: 110
1185619893_1185619897 -2 Left 1185619893 X:1447433-1447455 CCATCTTGGACACACACCATCTT 0: 8
1: 9
2: 11
3: 58
4: 284
Right 1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG 0: 1
1: 2
2: 26
3: 23
4: 110
1185619890_1185619897 17 Left 1185619890 X:1447414-1447436 CCATCTTGGATAAGCACCACCAT 0: 16
1: 21
2: 42
3: 78
4: 178
Right 1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG 0: 1
1: 2
2: 26
3: 23
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619897 Original CRISPR TTGGACACACACGGCCATGT TGG Intronic
900119397 1:1042049-1042071 CTGGGCACACACGGGCCTGTAGG - Exonic
900181626 1:1313596-1313618 CAGGACACACAGGGCCAGGTGGG + Intronic
901383915 1:8894059-8894081 TTTGACACACATGGCCACCTTGG + Intergenic
903876254 1:26475428-26475450 TTTGACACACATGGCCACCTTGG + Exonic
905451340 1:38058771-38058793 TTGGACACACAAGGACACCTTGG - Intergenic
909495976 1:76279163-76279185 TTGGACACACACAGCCAGGCAGG + Intronic
915336937 1:155149407-155149429 TTTGACACACATGGCCACCTTGG + Intergenic
915843035 1:159232331-159232353 TTGTAAACACAAGACCATGTCGG - Intergenic
922952544 1:229571084-229571106 TTTGACACACATGGCCACCTTGG + Intergenic
1065981075 10:30897803-30897825 TGGGGCACACAGGGCCTTGTGGG + Intronic
1066314649 10:34232405-34232427 CTGGTAAAACACGGCCATGTGGG + Intronic
1072414148 10:95232831-95232853 TTGGTCCCACAAGGCCATGAGGG + Intergenic
1073982298 10:109168606-109168628 TTAGACACACAGGGACATGAGGG - Intergenic
1076919339 10:133443192-133443214 GTGGACAGACAAGGCCATGACGG + Intergenic
1085074736 11:73580791-73580813 TTTGACACACATGGCCACCTTGG + Intronic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1104345445 12:127992410-127992432 TTACACACACATGGACATGTTGG - Intergenic
1105544945 13:21344480-21344502 TTGTTCACACACAGCCAAGTTGG + Intergenic
1107651137 13:42546404-42546426 TTGGACACAGACAGGCATGCAGG + Intergenic
1114511289 14:23263609-23263631 TTTGACACACATGGCCACCTTGG - Intronic
1114553056 14:23545134-23545156 TTGGCCAGACAGGGCAATGTGGG - Intronic
1117941524 14:60971958-60971980 TTTGACACACATGGCCACCTTGG - Exonic
1119743610 14:77028895-77028917 TTGTACACACACGGCGAGGGGGG - Intergenic
1121064459 14:90949264-90949286 TTGGACATTCAAGGCTATGTAGG - Intronic
1124445858 15:29731262-29731284 TTTGACACACATGGCCACCTTGG + Intronic
1128186163 15:65645001-65645023 TGGGACAGCCACTGCCATGTGGG + Intronic
1132179220 15:99739191-99739213 TTGGATACTGACGGCCATCTGGG - Intergenic
1132698950 16:1214127-1214149 TGGGACACTCACGGCCAGGTTGG - Intronic
1133003874 16:2866783-2866805 TTGGACACAGCCGACCGTGTTGG - Intergenic
1133933088 16:10248274-10248296 TAGTAGACACAGGGCCATGTTGG + Intergenic
1135858295 16:26032239-26032261 TTTGACACACATGGCCACCTTGG - Intronic
1137062329 16:35802612-35802634 TTTGACACACATGGCCACCTTGG - Intergenic
1139661124 16:68421527-68421549 TTGCACAAACACTGCCAGGTTGG - Intronic
1140381154 16:74489001-74489023 CTGGACACACAGGGTGATGTGGG + Intronic
1141883950 16:86879104-86879126 TGGGACACTCACGGCCATGGGGG + Intergenic
1144140460 17:12342498-12342520 TTGGCCACACACGCCCTTATGGG - Intergenic
1147753567 17:42753233-42753255 TTTGACACACATGGCCACCTTGG - Intergenic
1148443560 17:47724525-47724547 GAGGACACCCAAGGCCATGTTGG - Intergenic
1152762241 17:82114924-82114946 TTGGCCCCACACTGCCATGGAGG + Intronic
1153837498 18:8977094-8977116 TTGGCCACACCCGGCCACCTTGG - Intergenic
1155824183 18:30418383-30418405 TTTGAGACACACTGCCATTTGGG + Intergenic
1159611718 18:70533055-70533077 TTGGTAACACACGCCCATTTGGG - Intergenic
1160016436 18:75144390-75144412 ATGAACACACACCCCCATGTAGG - Intergenic
1161312976 19:3604861-3604883 TTGGACCCACAGGGCCCTTTTGG + Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1162762115 19:12894929-12894951 CTGGTCACACAGGGCCTTGTGGG - Intronic
1166050054 19:40253596-40253618 TTGAAAACACAAGGCCATGGGGG + Intronic
925080882 2:1065106-1065128 CTGGAGCCACACAGCCATGTGGG + Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
925315498 2:2919714-2919736 CTGGACACACCCGGCCCTGCAGG + Intergenic
925333185 2:3074553-3074575 TTGGTAACACACACCCATGTGGG - Intergenic
925381272 2:3427958-3427980 TAGGATACACAAGGCGATGTTGG - Intronic
928399728 2:30969217-30969239 TTGGACACACCCGGTCCTGGTGG - Intronic
933318407 2:80742337-80742359 TTGCACAAACACAGCCATGGAGG + Intergenic
935959776 2:108413616-108413638 TTGGCCACACCCTGCCCTGTTGG + Intergenic
936492082 2:112980868-112980890 TTTGACACACATGGCCACCTTGG - Intronic
941655598 2:168141059-168141081 ATGGACATACTCGGGCATGTTGG - Intronic
1170157298 20:13280355-13280377 TGAGACACACACGTTCATGTGGG - Intronic
1172293185 20:33790612-33790634 TTGGACACACAGGGCTGGGTTGG + Intronic
1176267430 20:64217555-64217577 TTGGACACACACGCCCGTAACGG - Intronic
1179628901 21:42664776-42664798 TTGGGTACACACGGCCGGGTCGG + Intronic
1184785544 22:46669959-46669981 TGGGCCACACACTGGCATGTGGG + Intronic
949099369 3:125628-125650 CTGGACACACAGGGCTTTGTAGG + Intergenic
950778962 3:15374767-15374789 TTTGACACACATGGCCACCTTGG - Intergenic
961371540 3:126434723-126434745 TGGGGCAAACACGGCCAGGTAGG + Intronic
963398894 3:144771472-144771494 TTTGACACACATGGGCATGAAGG - Intergenic
965103119 3:164328464-164328486 ATGGACACACAGGGGCCTGTCGG + Intergenic
979687463 4:123526686-123526708 TTGCACACACAGTGCCAGGTAGG - Intergenic
979967648 4:127094720-127094742 TTGGACTCATACAACCATGTAGG - Intergenic
988801537 5:34700443-34700465 TTGGACACAGTAGGACATGTGGG + Intronic
992101367 5:73410702-73410724 TTTGACACACATGGCCACCTTGG + Intergenic
992381455 5:76241721-76241743 TTTGACACACATGGCCACCTTGG - Intronic
1002261161 5:177994971-177994993 CTGGACACACACGACCACCTGGG + Intronic
1002397729 5:178971209-178971231 CAGGCCACACAGGGCCATGTGGG + Intergenic
1002523265 5:179802885-179802907 TTGGAAACAGAAGGCCTTGTAGG - Exonic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1004522252 6:16373066-16373088 AGGGACACATAGGGCCATGTAGG + Intronic
1009996533 6:70901477-70901499 TTTGACACACACACCAATGTGGG - Intronic
1010625296 6:78131248-78131270 ATGGAAACACACTGCCATGAAGG + Intergenic
1010727702 6:79354157-79354179 TTTGACACACATGGCCACCTTGG - Intergenic
1014434772 6:121409088-121409110 TTTGACACACATGGCCAGCTTGG + Intergenic
1028264270 7:88703825-88703847 ATGGACAAATACGGCCAGGTGGG - Intergenic
1032233487 7:130098533-130098555 TTGTACACACATGGCCAAGCAGG + Intronic
1042458393 8:69032343-69032365 TTGGACACACACGTGCACATAGG - Intergenic
1042817570 8:72894337-72894359 GTGGAGGCACAAGGCCATGTGGG + Intronic
1045494141 8:102694010-102694032 TAGACCACACAGGGCCATGTGGG + Intergenic
1050406323 9:5312182-5312204 TTTGACACACATGGCCACCTTGG + Intergenic
1051101212 9:13524093-13524115 TTTGTCACACAAGACCATGTGGG + Intergenic
1056180665 9:84079297-84079319 TTTGACACACATGGCCACCTTGG + Intergenic
1057247808 9:93472511-93472533 TTGGACACACAAGGCCAGTTTGG + Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186938163 X:14474081-14474103 TTGTACACACACAGCCACTTAGG - Intergenic
1187736015 X:22304253-22304275 TTGGAGAGAGACTGCCATGTTGG + Intergenic
1187938005 X:24354518-24354540 TTTGACACACATGGCCACCTTGG + Intergenic
1188103579 X:26120940-26120962 TTGGAAACACATGCCCAGGTGGG - Intergenic
1196869297 X:120097674-120097696 TTGCAGACACACGTGCATGTAGG - Intergenic
1199212153 X:145225364-145225386 TTAGAAACACATGGCCATATGGG - Intergenic
1199999595 X:153051854-153051876 TTTGACACACATGGCCACCTTGG - Intergenic