ID: 1185619914

View in Genome Browser
Species Human (GRCh38)
Location X:1447565-1447587
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 16, 1: 10, 2: 3, 3: 9, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619907_1185619914 20 Left 1185619907 X:1447522-1447544 CCACCATCTTGGACACACACCAT 0: 10
1: 8
2: 18
3: 47
4: 190
Right 1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG 0: 16
1: 10
2: 3
3: 9
4: 140
1185619908_1185619914 17 Left 1185619908 X:1447525-1447547 CCATCTTGGACACACACCATCTT 0: 8
1: 9
2: 11
3: 58
4: 284
Right 1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG 0: 16
1: 10
2: 3
3: 9
4: 140
1185619911_1185619914 1 Left 1185619911 X:1447541-1447563 CCATCTTGGACACACACGGCCAT 0: 3
1: 26
2: 35
3: 81
4: 201
Right 1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG 0: 16
1: 10
2: 3
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902717127 1:18280583-18280605 TAGCAATAGCACCACCATCTAGG - Intronic
903335403 1:22621171-22621193 TTGAGTAAGCAACCCCATCTTGG - Intergenic
904051904 1:27645055-27645077 TTGGCAAAGCACCACCCCCTGGG - Intergenic
905018541 1:34793304-34793326 TTGGATAAGGAACAACCTCTGGG - Intronic
905608827 1:39330737-39330759 TGGGATAAGCCCCAACATGTAGG - Intronic
909411963 1:75364608-75364630 TTGGGAAAACACCACCATCCAGG - Intronic
911477466 1:98391185-98391207 TTGGAATAGCAACACCATTTGGG - Intergenic
916793736 1:168146587-168146609 ATGGAAAAGCATTACCATCTGGG - Intergenic
921933923 1:220778492-220778514 ATGGTTTAGCACCACCACCTTGG - Intronic
1065923779 10:30417562-30417584 TTGGATGGGGACCAGCATCTGGG + Intergenic
1066056505 10:31686002-31686024 TAGCATCAGCACCTCCATCTTGG + Intergenic
1068050099 10:51939609-51939631 TTTGAGAAACACCACTATCTTGG + Intronic
1070127585 10:73634579-73634601 TCTGATCAGCAGCACCATCTGGG - Exonic
1074292895 10:112154117-112154139 TGGGATTAGGACCACAATCTTGG - Intronic
1074420414 10:113303813-113303835 TTGCATAACCACCACCAAATAGG - Intergenic
1074702713 10:116106554-116106576 ATGGTTTAGCACCACCCTCTTGG + Intronic
1080798410 11:35587294-35587316 TTGGAGAAGCACCAAGATCAGGG - Intergenic
1081059941 11:38461876-38461898 TTGGAAACGCACACCCATCTGGG - Intergenic
1090050199 11:123371240-123371262 TTGGGTAATCCCCACCATCTTGG + Intergenic
1091325411 11:134683313-134683335 GTGGATAAGCACAATTATCTGGG + Intergenic
1097767975 12:63547418-63547440 ATGGATGAGCAAGACCATCTTGG - Intergenic
1097784335 12:63742484-63742506 ATGGATGAGCAAGACCATCTTGG - Intergenic
1099109730 12:78543314-78543336 TTTGCTAAGCCCCAACATCTTGG - Intergenic
1099941853 12:89198224-89198246 ATGGTTTAGCACCACCCTCTTGG + Intergenic
1101257015 12:102988701-102988723 TTAGAGAACCAGCACCATCTGGG - Intergenic
1102231655 12:111266727-111266749 GTAGAAAAGCACCACCAACTGGG - Intronic
1103503012 12:121419512-121419534 TTGGGTATACACCACCATTTGGG + Intronic
1108715930 13:53077812-53077834 ATGGTTAAGCACCATCCTCTTGG - Intergenic
1109294615 13:60514390-60514412 TTGGATGAGCACCATGACCTTGG + Intronic
1110822901 13:79936921-79936943 TTAGTTAAACACCACAATCTTGG - Intergenic
1111416324 13:87950132-87950154 TCAGATATGCACCACCAGCTGGG - Intergenic
1113355457 13:109575932-109575954 TAGGAAAAGCACTACCTTCTGGG - Intergenic
1117369398 14:55062887-55062909 CTGGATAAGGACCACCAGGTGGG - Exonic
1118954089 14:70463807-70463829 TTGCATAAGCTCCTCCTTCTTGG - Intergenic
1121679182 14:95778493-95778515 TTGGATGAGGCCCACCATATTGG + Intergenic
1125709314 15:41771959-41771981 GTGGTTAAGCAACACCATCTAGG - Intronic
1128495831 15:68198020-68198042 ATGGATCAGCACCCCCACCTGGG + Intronic
1135340823 16:21646570-21646592 TTGGTTAAACATCACCATGTAGG + Intronic
1135560195 16:23470250-23470272 ATGGAGAAGCAACAGCATCTGGG - Intronic
1137872187 16:51961019-51961041 ATTGATAAGAACCACCTTCTAGG - Intergenic
1140716097 16:77727052-77727074 ATGGTTTAGCACCATCATCTTGG - Intronic
1161948526 19:7454091-7454113 TGGGATTAGCAGCACCATCTTGG + Intronic
1161948549 19:7454190-7454212 TTGGATCAGTGGCACCATCTTGG + Intronic
926929790 2:18025122-18025144 TTGGTTAAGCCCTAGCATCTGGG + Intronic
927485572 2:23486342-23486364 AGGGATAAGCCCCAGCATCTCGG - Intronic
930165468 2:48199487-48199509 CTGGATGAGCACCAGCATCAGGG - Intergenic
930600403 2:53436270-53436292 TGGGATAAGAACCACCAGCCAGG + Intergenic
931824226 2:65982870-65982892 ATGGTTTAGCACCACCACCTTGG + Intergenic
933698098 2:85235406-85235428 TTGGTTTATCACCACCCTCTGGG + Intronic
934965839 2:98721318-98721340 GTGGATTTGAACCACCATCTGGG - Intronic
937376107 2:121336805-121336827 TTGGGTAACCATCACCATCATGG - Intergenic
938593843 2:132766641-132766663 TTTGATAAGCACCTAGATCTTGG + Intronic
940363199 2:152817859-152817881 CTGGATAGGCACCAAAATCTGGG + Intergenic
940656608 2:156494712-156494734 TGGGAAAAACACCACCATCATGG + Intronic
944311137 2:198235173-198235195 ATGGCTTAGCACCACCCTCTTGG - Intronic
946511826 2:220366290-220366312 TTGGCTAAGGGCCATCATCTGGG - Intergenic
948382674 2:237561670-237561692 GTGGTTAAGTATCACCATCTTGG - Intergenic
1169676010 20:8155952-8155974 TTGACTAAGCAGCAGCATCTGGG + Intronic
1170098273 20:12670890-12670912 TTGGATAACCCCCAAGATCTGGG + Intergenic
1173408180 20:42785705-42785727 TTGGATAAGTAGCCTCATCTGGG - Intronic
1176007176 20:62872151-62872173 TTGGTTAAGAAACAGCATCTGGG - Intergenic
1177659043 21:24058331-24058353 TTGGATGAGCACCACAGTTTGGG - Intergenic
949183863 3:1167395-1167417 TTGGATATGGATCCCCATCTGGG - Intronic
952928049 3:38336295-38336317 TTTGAAAAGTACCACCAACTAGG + Intergenic
953591723 3:44263022-44263044 TTGGAGAAGCATCATCATGTAGG + Intronic
954154987 3:48680460-48680482 CTGGATAAACACCCCCAACTAGG + Intronic
954570893 3:51639930-51639952 GTGGAAAAGCAGTACCATCTTGG - Exonic
957876234 3:86149939-86149961 ATGGTTTAGCACCACCACCTTGG + Intergenic
960906879 3:122610534-122610556 TTGGAGGAGGACCACTATCTCGG + Exonic
969026237 4:4174994-4175016 TTGGATGTCCACAACCATCTTGG + Intergenic
973028133 4:45299906-45299928 TTGGTTTAGCACCATCCTCTAGG + Intergenic
975220513 4:71808144-71808166 TTGGATACGTACTACCATCCAGG - Intergenic
976542398 4:86293826-86293848 ATGGATTAGCACCATCCTCTTGG - Intronic
977331943 4:95647401-95647423 TTTGGTAAGCAGCAGCATCTAGG - Intergenic
977392727 4:96432292-96432314 TTGGAATACCACCACCATATTGG + Intergenic
982045432 4:151440610-151440632 TAGGATAGTCACCACCATCATGG + Intronic
983075050 4:163316198-163316220 ATGGTTTAGCACCACCCTCTTGG - Intergenic
986773054 5:10990635-10990657 TTTAATAAACACCACCATCTGGG - Intronic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
989416748 5:41186931-41186953 TTGGAAAAGCATTAGCATCTTGG - Intronic
990328278 5:54699348-54699370 ATGGAGAAGAATCACCATCTTGG - Intergenic
990417211 5:55597939-55597961 TTGGGCCAGCCCCACCATCTGGG - Intergenic
990537758 5:56739786-56739808 TTGTTTGAGCACCAGCATCTAGG + Intergenic
990976449 5:61565517-61565539 TTGGATACTCACCACTACCTGGG + Intergenic
992293551 5:75304899-75304921 TGAGAGCAGCACCACCATCTTGG + Intergenic
999160651 5:149494295-149494317 GAGGATAAGCACAACCATATGGG + Intronic
1000571421 5:162918866-162918888 GTGGATAACCAACACCATTTTGG + Intergenic
1003347068 6:5279829-5279851 TTGGATGAGGACCACCACATTGG + Intronic
1004890423 6:20095850-20095872 TTGATTGAGCACCACCATCAAGG + Intergenic
1005669966 6:28095456-28095478 ATGGTTTAGCACCACCTTCTTGG + Intergenic
1012582843 6:100889890-100889912 CTGGATAAGGACCACCAGGTGGG - Intergenic
1012716136 6:102672990-102673012 CTGGTTAAGCTCCACCATTTTGG + Intergenic
1015546430 6:134366502-134366524 TTGCAGAAGCTCCACCATTTTGG - Intergenic
1018932906 6:168253553-168253575 CAGGAGAAGCACCATCATCTCGG - Intergenic
1020712982 7:11631804-11631826 TTAGATAAGCAACACCATTTTGG + Intronic
1020713197 7:11635341-11635363 TTGGATAAACCAGACCATCTGGG - Intronic
1021763575 7:23924975-23924997 TTGGAAATGCAGCAGCATCTAGG - Intergenic
1023632219 7:42176202-42176224 TTGGGTCAGCACCAGCATATGGG - Intronic
1030913954 7:115289218-115289240 TTGGTTTAGCACCATCCTCTTGG - Intergenic
1036637034 8:10558278-10558300 ATGGTTAAGCACCATCACCTTGG - Intergenic
1040568322 8:48586790-48586812 TTGGAGCAGCACCACCATGGCGG - Intergenic
1041754543 8:61299706-61299728 TTGGATGAACACCACCACATAGG + Exonic
1043613859 8:82101201-82101223 TTGGAAAAGCATCTTCATCTAGG + Intergenic
1044536884 8:93367483-93367505 TTTGTTAAGCACCACCACTTTGG + Intergenic
1044684228 8:94811745-94811767 ATGGTTTAGCACCATCATCTTGG - Intergenic
1045702432 8:104882111-104882133 TGACAGAAGCACCACCATCTGGG - Intronic
1051135800 9:13919137-13919159 TTGGAAAAGCCCCACCATAATGG + Intergenic
1055927969 9:81530296-81530318 TAGGATAAAGACCATCATCTTGG + Intergenic
1056525777 9:87441744-87441766 ATGGTTTAGCACCACCCTCTTGG - Intergenic
1056637571 9:88344370-88344392 ATGGATCAGAACCACCCTCTTGG + Intergenic
1057373100 9:94491713-94491735 TTGGACAAGCAACAACACCTGGG - Intergenic
1058901575 9:109446874-109446896 TTGGATGAGATCAACCATCTTGG + Intronic
1061570912 9:131476961-131476983 GTGGAGAAGCAGAACCATCTAGG - Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619982 X:1448042-1448064 TTGGATAAGAACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186177811 X:6943764-6943786 TTGGAAATGCAGCACCATTTAGG - Intergenic
1195010740 X:100730766-100730788 GTAGAAAAGCACCACCAACTTGG - Intronic
1197413984 X:126151507-126151529 ATGGATTAGCACCATCCTCTTGG - Intergenic
1197683888 X:129417510-129417532 AGGGATAAGCACCAACCTCTAGG + Intergenic
1201639660 Y:16165593-16165615 GTGGATAAGTTCCACTATCTGGG + Intergenic
1201663153 Y:16419731-16419753 GTGGATAAGTTCCACTATCTGGG - Intergenic
1201711740 Y:17000233-17000255 TAGGATTAGCACCATCTTCTTGG + Intergenic