ID: 1185619914

View in Genome Browser
Species Human (GRCh38)
Location X:1447565-1447587
Sequence TTGGATAAGCACCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619908_1185619914 17 Left 1185619908 X:1447525-1447547 CCATCTTGGACACACACCATCTT No data
Right 1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG No data
1185619911_1185619914 1 Left 1185619911 X:1447541-1447563 CCATCTTGGACACACACGGCCAT No data
Right 1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG No data
1185619907_1185619914 20 Left 1185619907 X:1447522-1447544 CCACCATCTTGGACACACACCAT No data
Right 1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619914 Original CRISPR TTGGATAAGCACCACCATCT TGG Intronic