ID: 1185619929

View in Genome Browser
Species Human (GRCh38)
Location X:1447668-1447690
Sequence ATGGTGGTGCTTCTCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619929_1185619935 17 Left 1185619929 X:1447668-1447690 CCATCTTGGAGAAGCACCACCAT No data
Right 1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG No data
1185619929_1185619936 27 Left 1185619929 X:1447668-1447690 CCATCTTGGAGAAGCACCACCAT No data
Right 1185619936 X:1447718-1447740 ACTGCCATCTTGGACATGCATGG No data
1185619929_1185619933 -2 Left 1185619929 X:1447668-1447690 CCATCTTGGAGAAGCACCACCAT No data
Right 1185619933 X:1447689-1447711 ATCTTGGACACACACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619929 Original CRISPR ATGGTGGTGCTTCTCCAAGA TGG (reversed) Intronic