ID: 1185619931

View in Genome Browser
Species Human (GRCh38)
Location X:1447684-1447706
Sequence ATGGTGTGTGTCCAAGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619931_1185619936 11 Left 1185619931 X:1447684-1447706 CCACCATCTTGGACACACACCAT No data
Right 1185619936 X:1447718-1447740 ACTGCCATCTTGGACATGCATGG No data
1185619931_1185619935 1 Left 1185619931 X:1447684-1447706 CCACCATCTTGGACACACACCAT No data
Right 1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619931 Original CRISPR ATGGTGTGTGTCCAAGATGG TGG (reversed) Intronic