ID: 1185619932 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:1447687-1447709 |
| Sequence | AAGATGGTGTGTGTCCAAGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185619932_1185619936 | 8 | Left | 1185619932 | X:1447687-1447709 | CCATCTTGGACACACACCATCTT | No data | ||
| Right | 1185619936 | X:1447718-1447740 | ACTGCCATCTTGGACATGCATGG | No data | ||||
| 1185619932_1185619935 | -2 | Left | 1185619932 | X:1447687-1447709 | CCATCTTGGACACACACCATCTT | No data | ||
| Right | 1185619935 | X:1447708-1447730 | TTGGACAAGCACTGCCATCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185619932 | Original CRISPR | AAGATGGTGTGTGTCCAAGA TGG (reversed) | Intronic | ||