ID: 1185619932

View in Genome Browser
Species Human (GRCh38)
Location X:1447687-1447709
Sequence AAGATGGTGTGTGTCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619932_1185619935 -2 Left 1185619932 X:1447687-1447709 CCATCTTGGACACACACCATCTT No data
Right 1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG No data
1185619932_1185619936 8 Left 1185619932 X:1447687-1447709 CCATCTTGGACACACACCATCTT No data
Right 1185619936 X:1447718-1447740 ACTGCCATCTTGGACATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619932 Original CRISPR AAGATGGTGTGTGTCCAAGA TGG (reversed) Intronic