ID: 1185619933 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:1447689-1447711 |
| Sequence | ATCTTGGACACACACCATCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185619926_1185619933 | 17 | Left | 1185619926 | X:1447649-1447671 | CCATCTTGGACACACACCGCCAT | No data | ||
| Right | 1185619933 | X:1447689-1447711 | ATCTTGGACACACACCATCTTGG | No data | ||||
| 1185619928_1185619933 | 1 | Left | 1185619928 | X:1447665-1447687 | CCGCCATCTTGGAGAAGCACCAC | No data | ||
| Right | 1185619933 | X:1447689-1447711 | ATCTTGGACACACACCATCTTGG | No data | ||||
| 1185619929_1185619933 | -2 | Left | 1185619929 | X:1447668-1447690 | CCATCTTGGAGAAGCACCACCAT | No data | ||
| Right | 1185619933 | X:1447689-1447711 | ATCTTGGACACACACCATCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185619933 | Original CRISPR | ATCTTGGACACACACCATCT TGG | Intronic | ||