ID: 1185619934 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:1447703-1447725 |
Sequence | ATGGCAGTGCTTGTCCAAGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1185619934_1185619939 | 20 | Left | 1185619934 | X:1447703-1447725 | CCATCTTGGACAAGCACTGCCAT | No data | ||
Right | 1185619939 | X:1447746-1447768 | TTTGACACACACCACCATCTTGG | No data | ||||
1185619934_1185619936 | -8 | Left | 1185619934 | X:1447703-1447725 | CCATCTTGGACAAGCACTGCCAT | No data | ||
Right | 1185619936 | X:1447718-1447740 | ACTGCCATCTTGGACATGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1185619934 | Original CRISPR | ATGGCAGTGCTTGTCCAAGA TGG (reversed) | Intronic | ||