ID: 1185619935

View in Genome Browser
Species Human (GRCh38)
Location X:1447708-1447730
Sequence TTGGACAAGCACTGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 2, 1: 1, 2: 9, 3: 63, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619929_1185619935 17 Left 1185619929 X:1447668-1447690 CCATCTTGGAGAAGCACCACCAT 0: 3
1: 33
2: 43
3: 80
4: 234
Right 1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG 0: 2
1: 1
2: 9
3: 63
4: 134
1185619928_1185619935 20 Left 1185619928 X:1447665-1447687 CCGCCATCTTGGAGAAGCACCAC 0: 1
1: 11
2: 6
3: 28
4: 226
Right 1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG 0: 2
1: 1
2: 9
3: 63
4: 134
1185619931_1185619935 1 Left 1185619931 X:1447684-1447706 CCACCATCTTGGACACACACCAT 0: 10
1: 8
2: 18
3: 47
4: 190
Right 1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG 0: 2
1: 1
2: 9
3: 63
4: 134
1185619932_1185619935 -2 Left 1185619932 X:1447687-1447709 CCATCTTGGACACACACCATCTT 0: 8
1: 9
2: 11
3: 58
4: 284
Right 1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG 0: 2
1: 1
2: 9
3: 63
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619935 Original CRISPR TTGGACAAGCACTGCCATCT TGG Intronic
903368962 1:22822700-22822722 CAGGACATGCACTGGCATCTGGG + Intronic
905999339 1:42410466-42410488 TTGGAGAAAAACTCCCATCTGGG + Intronic
906137567 1:43510266-43510288 TTGGACATCCTCTGCCATCTTGG + Intergenic
908647947 1:66300036-66300058 TTGCACAAACACAGACATCTAGG + Intronic
913016542 1:114742379-114742401 TGGGACAAGCACGGCCAACATGG + Intronic
916001818 1:160623809-160623831 TGTGACTAGCACTGCCATCAGGG - Intronic
916793736 1:168146587-168146609 ATGGAAAAGCATTACCATCTGGG - Intergenic
919800975 1:201354435-201354457 TGGCCCAAGCACTGCAATCTGGG + Intergenic
1063123607 10:3122185-3122207 TTGGCCAGGCACAGCCACCTTGG + Intronic
1064582374 10:16807674-16807696 TTGGGCTAGCCCTGCCAGCTTGG - Intronic
1065015928 10:21462813-21462835 TTTGACAGGCACTTCCATGTGGG - Intergenic
1065730969 10:28709300-28709322 TTGGAGAAGCAGTTCCAGCTGGG + Intergenic
1066261059 10:33730155-33730177 GTGGACAAGCACTGGTATCTTGG + Intergenic
1068729669 10:60342763-60342785 TTTGGAAAGCACTGCCATATAGG - Intronic
1068785166 10:60964331-60964353 TTGGGCCACCACTGCCCTCTAGG + Intronic
1068877883 10:62016671-62016693 TTAGAAAAGCACTGGCTTCTTGG + Intronic
1070070145 10:73080288-73080310 TTTGAGAAGCACTGCCATATAGG - Intronic
1073290723 10:102412010-102412032 TTGGCCATGCCCAGCCATCTTGG + Intronic
1074030090 10:109678346-109678368 TTGAACAAGCACTACAAACTGGG + Intergenic
1075180500 10:120206779-120206801 TTGGACATGCACTGCCAAGATGG - Intergenic
1081059941 11:38461876-38461898 TTGGAAACGCACACCCATCTGGG - Intergenic
1081431999 11:42986468-42986490 TTGGAAATGAACTGCCCTCTTGG - Intergenic
1091447579 12:552840-552862 TTAGAGAAGCACTGTCTTCTGGG + Intronic
1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG + Intronic
1097429985 12:59493666-59493688 TTGAGCAAGCACTGCAATCTCGG + Intergenic
1100904976 12:99286933-99286955 TGGGACAAGAAATGCCATTTAGG - Intronic
1108526126 13:51287510-51287532 TTGGAGAAGCCCAGCCCTCTAGG - Intergenic
1111487491 13:88923166-88923188 TTGGTGAAGCACTGAAATCTTGG + Intergenic
1113355457 13:109575932-109575954 TAGGAAAAGCACTACCTTCTGGG - Intergenic
1118445388 14:65846396-65846418 TTGGTTAAGCCCTGCCAACTAGG + Intergenic
1118710812 14:68518097-68518119 TTGAACAAACGCTGCCTTCTGGG - Intronic
1121618587 14:95330889-95330911 TTGAAAAATCACTGCTATCTGGG - Intergenic
1122434818 14:101688288-101688310 GAGCAGAAGCACTGCCATCTTGG + Intergenic
1128186163 15:65645001-65645023 TGGGACAGCCACTGCCATGTGGG + Intronic
1131159787 15:90098166-90098188 TTGCACAAACACTGTCCTCTTGG + Intronic
1133443078 16:5836823-5836845 GTGGACAAGCATTCTCATCTGGG - Intergenic
1134100340 16:11447590-11447612 TAGGACGAGCAGAGCCATCTTGG - Intronic
1139661124 16:68421527-68421549 TTGCACAAACACTGCCAGGTTGG - Intronic
1144032874 17:11337665-11337687 CTGGCCAAGCAAAGCCATCTTGG - Intronic
1145312475 17:21708145-21708167 TGGGGCAGGGACTGCCATCTCGG + Intergenic
1149473120 17:56935558-56935580 TTGGAGAACCACTGACATCGTGG - Intergenic
1150837888 17:68580907-68580929 TTGTACTAGCAGTGCCACCTTGG - Intronic
1151965029 17:77426658-77426680 TTGCTGAAGCGCTGCCATCTTGG + Intronic
1153589804 18:6661569-6661591 CTGGACAAGAAAAGCCATCTGGG + Intergenic
1158259326 18:55589913-55589935 GTCGACCAGCACCGCCATCTTGG - Intronic
1161566858 19:5007209-5007231 TTGGCCAGGCTCTGCCATATTGG + Intronic
1165949447 19:39465799-39465821 TCCCACCAGCACTGCCATCTGGG - Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
926588230 2:14712451-14712473 TTGGAGATGCACTGCTCTCTCGG - Intergenic
928217681 2:29375863-29375885 GAGGAGGAGCACTGCCATCTTGG + Intronic
929028582 2:37629425-37629447 CTGGAGTAGCAGTGCCATCTGGG + Intergenic
936523729 2:113228764-113228786 TTGGACAAGCAGTGCCATAGAGG - Intronic
937739547 2:125333831-125333853 TTGTTCCAGCAATGCCATCTGGG - Intergenic
943219409 2:185085742-185085764 TTTGACAACCGCTGCCATATAGG - Intergenic
946035899 2:216742001-216742023 TTGGAGGAGCTCTGCTATCTGGG + Intergenic
946124659 2:217552054-217552076 TAAGACAAGCACTACCCTCTTGG + Intronic
1170834225 20:19869860-19869882 TGGGTCCAGCACTGTCATCTGGG - Intergenic
1173426172 20:42945549-42945571 TGGGACAAGCCCTGCCCTGTTGG - Intronic
1178692613 21:34761919-34761941 TTGGGAGATCACTGCCATCTTGG - Intergenic
1179984803 21:44914298-44914320 TTGCACCAGCACTTCCTTCTCGG - Intronic
1181788170 22:25242684-25242706 TTGGACAGAAACTGCTATCTCGG - Intergenic
954562265 3:51567337-51567359 TTGGACAAGAACTTCCTACTTGG - Intronic
954570893 3:51639930-51639952 GTGGAAAAGCAGTACCATCTTGG - Exonic
959575136 3:107925793-107925815 TTGGACAAGGCCTGCCATAGTGG - Intergenic
963709498 3:148730654-148730676 TTTGAAAAGCACTGCCCTGTAGG - Intronic
967600542 3:191382420-191382442 GTGGCCAAGCACACCCATCTAGG + Intronic
968743465 4:2343710-2343732 TTGGGCAAGCTGTGCCACCTGGG - Intronic
968743473 4:2343757-2343779 TTGGGCAAGCTGTGCCACCTGGG - Intronic
969213623 4:5707031-5707053 TTGCACAAGCTCTTCCTTCTGGG - Intronic
969583826 4:8080730-8080752 TTGGACAAGCACTGGCACTTGGG - Exonic
969590304 4:8118229-8118251 TTGCACACTGACTGCCATCTGGG + Intronic
971020024 4:22525419-22525441 ATTGACCAGCACTGCCATGTGGG + Intergenic
976145402 4:82038116-82038138 TTTGAAAAGCACTGCTATATAGG - Intronic
976154088 4:82124111-82124133 TTTGAGAACCACTGCCCTCTAGG - Intergenic
977254219 4:94722426-94722448 TTGCAAAAGGACTGCCAGCTGGG + Intergenic
978102871 4:104864124-104864146 TTGCATAAGCAATGTCATCTGGG + Intergenic
982448220 4:155519995-155520017 TTGCACAAACAGTGCCATCTAGG - Intergenic
983324190 4:166232379-166232401 ATGCACAAGCACTGATATCTTGG + Intergenic
985656746 5:1135847-1135869 TTTGACAAACAGTGCCAGCTTGG + Intergenic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
989416748 5:41186931-41186953 TTGGAAAAGCATTAGCATCTTGG - Intronic
990004765 5:50933372-50933394 TTAGCCAAGAACTGCCATGTAGG - Intergenic
992371227 5:76146176-76146198 TTGGACAAGAGCAGCCATGTAGG + Intronic
996808720 5:127489041-127489063 GTGGGCAAGCATTACCATCTGGG - Intergenic
997280438 5:132640531-132640553 TAGGTAAAGCACTGCCCTCTGGG - Intronic
999564637 5:152843897-152843919 TTGGACAAGCAATGAAACCTCGG - Intergenic
1001000073 5:167997135-167997157 TTTGACAAGCACTGACACCGAGG + Intronic
1006226609 6:32543230-32543252 TTGGACAAGCTCTGCCTCCCGGG + Intergenic
1006439566 6:34045519-34045541 TTGGACAACCAAAGACATCTGGG - Intronic
1007628962 6:43262260-43262282 TGGGACTAGCAAGGCCATCTTGG + Intronic
1009603673 6:65837537-65837559 TTGGATAAACTCTGCCTTCTAGG - Intergenic
1013622026 6:111899326-111899348 TTCTACAAACACTGCCATTTCGG + Intergenic
1015711469 6:136146083-136146105 TTGGTCACTCACTGCCATCAGGG + Intronic
1017328930 6:153172973-153172995 TGTGACAATCACAGCCATCTGGG - Intergenic
1018929434 6:168230842-168230864 CTGATCAAGCCCTGCCATCTTGG - Intergenic
1020924066 7:14301936-14301958 TTGCTAAAGCACTGCCATTTGGG - Intronic
1022476259 7:30712395-30712417 TTTGAGAAGCTCTGCCGTCTAGG + Intronic
1023999472 7:45181220-45181242 TTGGAGAGGCCCTGCCATGTTGG + Intronic
1024489775 7:49967152-49967174 CTGGAGAAGCTCTGCCCTCTGGG - Intronic
1027939880 7:84664015-84664037 TTGGACTATCATTGCCTTCTTGG - Intergenic
1030607125 7:111649729-111649751 TTAGACAAGCCCAGCCACCTAGG + Intergenic
1030793999 7:113764753-113764775 TTGGACAAGCAATGAGATCCCGG - Intergenic
1031194591 7:118596489-118596511 TTGGAGAAGCACTCCTATTTTGG + Intergenic
1031199366 7:118660239-118660261 TTGAATAGTCACTGCCATCTTGG - Intergenic
1031439170 7:121772107-121772129 TTGGAGAAGCAGTGCCATATTGG - Intergenic
1032760749 7:134939186-134939208 TTGGGCAAGGACAGCCATCAGGG + Intronic
1035738825 8:1909926-1909948 ATGGACAAGCACTGCCTCCATGG - Intronic
1036905602 8:12706381-12706403 TTGTACAACCCCTGCCATATTGG - Intergenic
1036943848 8:13075734-13075756 TTGGACAGGTATTGCCATGTTGG - Intergenic
1038433978 8:27521818-27521840 GTGGATAGGCTCTGCCATCTAGG + Intronic
1042618792 8:70680373-70680395 TTGGCCCAGCAATTCCATCTAGG - Intronic
1043252926 8:78098456-78098478 TTGGACCCTCACTGACATCTAGG + Intergenic
1043557309 8:81446507-81446529 TTTGACAAGCACAGCAAACTCGG + Intronic
1043669585 8:82865370-82865392 GTGGACAACCACTTCCAGCTGGG - Intergenic
1044380886 8:91532026-91532048 TTGGACTAGCACTTCCAACCTGG - Intergenic
1044743805 8:95353315-95353337 CTGCACCAGCACTGCCCTCTAGG - Intergenic
1046464018 8:114579213-114579235 TTTGAGAACCACTGGCATCTGGG - Intergenic
1046622284 8:116541016-116541038 TTGAACAAGCAATGTCATGTTGG - Intergenic
1047138467 8:122107720-122107742 TTGGGCAAGCCCTGCCATCATGG - Intergenic
1048225924 8:132585212-132585234 CAGGAAAAGGACTGCCATCTAGG - Intronic
1052676765 9:31636187-31636209 CTGTACAACCACTGCCATTTGGG + Intergenic
1054813304 9:69451814-69451836 TTGTACAAACACTGCAATCTAGG - Intronic
1054969251 9:71065965-71065987 CTGAACCAGCACAGCCATCTGGG + Intronic
1058130392 9:101246126-101246148 TTGTATAAGCACTGAAATCTAGG + Intronic
1061422976 9:130482120-130482142 CAGGACCAGGACTGCCATCTGGG + Intronic
1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG + Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619982 X:1448042-1448064 TTGGATAAGAACCACCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1185716621 X:2347907-2347929 GTGGACAATCACTGCTGTCTTGG + Intronic
1187047018 X:15656720-15656742 TTCCACATGCACTGCCATATTGG - Intronic
1187667834 X:21633896-21633918 TTGGACCAGCAAAGTCATCTTGG - Intronic
1189179519 X:38990097-38990119 GTGCACAAGCAATGCCATCAGGG + Intergenic
1190949304 X:55127250-55127272 TGTGACTAGCACAGCCATCTTGG - Intronic