ID: 1185619936

View in Genome Browser
Species Human (GRCh38)
Location X:1447718-1447740
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619931_1185619936 11 Left 1185619931 X:1447684-1447706 CCACCATCTTGGACACACACCAT No data
Right 1185619936 X:1447718-1447740 ACTGCCATCTTGGACATGCATGG No data
1185619928_1185619936 30 Left 1185619928 X:1447665-1447687 CCGCCATCTTGGAGAAGCACCAC No data
Right 1185619936 X:1447718-1447740 ACTGCCATCTTGGACATGCATGG No data
1185619929_1185619936 27 Left 1185619929 X:1447668-1447690 CCATCTTGGAGAAGCACCACCAT No data
Right 1185619936 X:1447718-1447740 ACTGCCATCTTGGACATGCATGG No data
1185619932_1185619936 8 Left 1185619932 X:1447687-1447709 CCATCTTGGACACACACCATCTT No data
Right 1185619936 X:1447718-1447740 ACTGCCATCTTGGACATGCATGG No data
1185619934_1185619936 -8 Left 1185619934 X:1447703-1447725 CCATCTTGGACAAGCACTGCCAT No data
Right 1185619936 X:1447718-1447740 ACTGCCATCTTGGACATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type