ID: 1185619942

View in Genome Browser
Species Human (GRCh38)
Location X:1447765-1447787
Sequence TTGGACACACACCGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619938_1185619942 1 Left 1185619938 X:1447741-1447763 CCATCTTTGACACACACCACCAT No data
Right 1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG No data
1185619937_1185619942 20 Left 1185619937 X:1447722-1447744 CCATCTTGGACATGCATGGCCAT No data
Right 1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619942 Original CRISPR TTGGACACACACCGCCATCT TGG Intronic