ID: 1185619948

View in Genome Browser
Species Human (GRCh38)
Location X:1447803-1447825
Sequence TTGGACACACACAGCTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 1, 2: 25, 3: 35, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619944_1185619948 1 Left 1185619944 X:1447779-1447801 CCATCTTGGATAAGCACCACCAT 0: 16
1: 21
2: 42
3: 78
4: 178
Right 1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG 0: 1
1: 1
2: 25
3: 35
4: 164
1185619940_1185619948 23 Left 1185619940 X:1447757-1447779 CCACCATCTTGGACACACACCGC 0: 12
1: 16
2: 28
3: 56
4: 201
Right 1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG 0: 1
1: 1
2: 25
3: 35
4: 164
1185619943_1185619948 4 Left 1185619943 X:1447776-1447798 CCGCCATCTTGGATAAGCACCAC 0: 9
1: 4
2: 5
3: 28
4: 157
Right 1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG 0: 1
1: 1
2: 25
3: 35
4: 164
1185619941_1185619948 20 Left 1185619941 X:1447760-1447782 CCATCTTGGACACACACCGCCAT 0: 19
1: 27
2: 46
3: 99
4: 214
Right 1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG 0: 1
1: 1
2: 25
3: 35
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619948 Original CRISPR TTGGACACACACAGCTATCT TGG Intronic
903714032 1:25349877-25349899 TTAGACACACACAACTAAATGGG + Intronic
905974792 1:42166362-42166384 TTGCACAGACACAGATACCTTGG - Intergenic
907231024 1:52998613-52998635 ATGGACAGACACAGGTAGCTGGG - Intronic
907637425 1:56150078-56150100 TAGGACAGAAACAGGTATCTAGG + Intergenic
908222926 1:62026128-62026150 TTTGACATACTCAGCTATTTTGG + Intronic
908647947 1:66300036-66300058 TTGCACAAACACAGACATCTAGG + Intronic
909366863 1:74834858-74834880 ATAGACACACACAACTCTCTTGG - Intergenic
909495976 1:76279163-76279185 TTGGACACACACAGCCAGGCAGG + Intronic
909849261 1:80439693-80439715 TGGCACACAGACAGCTTTCTTGG + Intergenic
911502719 1:98708577-98708599 TTGCACACACACAGCTGGCGGGG + Intronic
914172217 1:145235214-145235236 TTGGACCCACGCAGTTGTCTTGG - Intergenic
915383224 1:155463191-155463213 TTGGACACATACATATATATTGG - Intronic
915675093 1:157522415-157522437 TTGCAGACACACAGCTAGCCAGG - Intronic
916801571 1:168221177-168221199 GTGAACACACAAAGCAATCTAGG + Intergenic
918084958 1:181237473-181237495 GTGGACACTCTCAGCTATTTGGG + Intergenic
918466328 1:184824903-184824925 ATTGACACACATAGCTACCTTGG + Intronic
918683492 1:187385424-187385446 TTGGAAACAGACAGATATCTTGG - Intergenic
1062794940 10:337778-337800 GTGCACACACACAGCTGCCTAGG - Intronic
1063374397 10:5545376-5545398 CTGGACACACACAGCTCCTTGGG - Intergenic
1063685486 10:8233442-8233464 CTGGGCACACATAGCCATCTAGG + Intergenic
1066157277 10:32691456-32691478 CTGGTCACACATTGCTATCTTGG + Intronic
1072553752 10:96498620-96498642 TTGGCCACAGACAGCTATTTGGG - Intronic
1074956770 10:118398173-118398195 ATACACACACACAACTATCTAGG + Intergenic
1075192984 10:120328571-120328593 TTGGACATAAACAGCAATCTAGG - Intergenic
1081059941 11:38461876-38461898 TTGGAAACGCACACCCATCTGGG - Intergenic
1081751556 11:45514725-45514747 TTTGACACACATAGCCACCTTGG + Intergenic
1082937604 11:58670635-58670657 TTGGACACCCCCAGCGATATGGG + Intronic
1083705525 11:64511802-64511824 TGGGACACCCACAGATATATGGG - Intergenic
1084261663 11:67983065-67983087 ATGCACACCCACTGCTATCTTGG - Intergenic
1084810981 11:71611046-71611068 ATGCACACCCACTGCTATCTTGG + Intergenic
1085840196 11:80002614-80002636 CTGGACACATACAGATATATAGG - Intergenic
1086799689 11:91156699-91156721 TTGGACACAGACATATACCTAGG + Intergenic
1087272363 11:96124315-96124337 TTGAACACTCACAGCTAGGTGGG + Intronic
1094002744 12:25713425-25713447 TTGGACACCGTCAGCTCTCTTGG + Intergenic
1099710407 12:86216823-86216845 TTGCAGACATACAACTATCTTGG + Intronic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1100866759 12:98865741-98865763 AGGGACTCACACAGATATCTGGG + Intronic
1103504212 12:121430330-121430352 CTGGACACTCACAGACATCTCGG + Exonic
1106084805 13:26531869-26531891 TTCGAGACTCACAGCTTTCTAGG - Intergenic
1107848836 13:44549831-44549853 GTTGACAGACACAGCTAGCTTGG - Intronic
1109672415 13:65626481-65626503 CTGGACACTCACAACTGTCTGGG + Intergenic
1113875265 13:113590285-113590307 TGGGACGCACACAGTTCTCTTGG - Intronic
1114156756 14:20112297-20112319 TTGGCCTCACACAGATATCCAGG + Intergenic
1117413390 14:55471003-55471025 TTGGACACACAGACCAATCTTGG + Intergenic
1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG + Intergenic
1127331061 15:57940457-57940479 TCTGACACACACAGCTACGTGGG - Intergenic
1130868569 15:87952582-87952604 TTGGTGACACAAAGTTATCTTGG + Intronic
1131968944 15:97873472-97873494 TTGGACACACAGAGATACCAGGG - Intergenic
1135083064 16:19452713-19452735 CTGAACAGACACAGCTTTCTGGG - Intronic
1136033209 16:27518537-27518559 TTGGAAACACACAGCTTTGGAGG + Intronic
1143157766 17:4849349-4849371 TTGGGGACACACAGCTTTGTTGG + Intronic
1145395166 17:22488773-22488795 GTGCTCACACCCAGCTATCTGGG - Intergenic
1146728342 17:35173691-35173713 TTGGGCCCACACAGAAATCTAGG + Intronic
1147306649 17:39568789-39568811 TTGGGCTCACCCAGCTACCTGGG + Intergenic
1148857650 17:50587533-50587555 TTGGACAGACCTGGCTATCTGGG + Intronic
1149802644 17:59584963-59584985 TTGCACACTTACAACTATCTCGG - Intronic
1149843847 17:59990529-59990551 TTGCACACTTACAACTATCTCGG + Intergenic
1150171824 17:63004404-63004426 TTTGACACACATAGCCACCTTGG - Intergenic
1150375318 17:64676592-64676614 TAGTACAAACACAGCTACCTGGG + Intergenic
1153892282 18:9528832-9528854 TTGGACCCACAGACCAATCTGGG - Intronic
1160342159 18:78098610-78098632 TATGACACACAGAGCTATCGAGG + Intergenic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1164608940 19:29619104-29619126 AGGTAAACACACAGCTATCTGGG - Intergenic
1168585986 19:57592400-57592422 TTGGACATACACAGATTTCTAGG - Exonic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
925750531 2:7086676-7086698 CTGGAAACACACAGCTTACTAGG - Intergenic
926780224 2:16463793-16463815 TTGGACACTCTCACCTATCTGGG + Intergenic
928229725 2:29487346-29487368 GTGGCCACAGACAGCTGTCTGGG - Intronic
931503692 2:62900151-62900173 TTGGAGAAACACAGATATCATGG + Intronic
932289714 2:70566605-70566627 ACAGACACACACAGCTATTTGGG - Intergenic
933304598 2:80581567-80581589 TAGCACCCACACAGCTATGTGGG - Intronic
935842716 2:107130943-107130965 TTTGACACACAGACCTTTCTGGG + Intergenic
935888119 2:107646980-107647002 TTGGTCACTCTCAGATATCTTGG + Intergenic
938962215 2:136354068-136354090 TTGGACACACAGAGATATCAGGG + Intergenic
940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG + Intergenic
942935107 2:181546409-181546431 ATGAAAGCACACAGCTATCTAGG + Intronic
943034231 2:182721065-182721087 TTGTAAACACACAGGTATCAAGG + Intronic
944893963 2:204145268-204145290 CTGGAGACACACAGTTCTCTTGG + Intergenic
947611326 2:231526699-231526721 TTGGACAGAGCCAGCTAACTGGG - Intronic
1169045105 20:2528747-2528769 TTGGACCCATCCAGGTATCTGGG - Intergenic
1169813758 20:9634877-9634899 TTGGACACTCACATTTCTCTTGG - Intronic
1170775005 20:19367523-19367545 TTGAACACTCACAGTTTTCTGGG - Intronic
1174398869 20:50265029-50265051 TTGGACAAATACAGTAATCTGGG + Intergenic
1174679221 20:52388743-52388765 TTGGACACACACAAGTTTCTAGG + Intergenic
1181339502 22:22166507-22166529 AGGGACACACACAGCAATCCTGG - Intergenic
1181788170 22:25242684-25242706 TTGGACAGAAACTGCTATCTCGG - Intergenic
1181871486 22:25902745-25902767 TGGGGGACACAGAGCTATCTTGG + Intronic
1184775831 22:46622245-46622267 TTGGACACGCACAGAACTCTTGG - Intronic
949882505 3:8672820-8672842 ATGCACACCCACTGCTATCTTGG + Intronic
950339648 3:12231379-12231401 TTGGACACAGACAGCTACAGAGG - Intergenic
951085929 3:18512572-18512594 TCACACACACACAGCTTTCTAGG - Intergenic
951660690 3:25061569-25061591 TTGAACACAGACAGCTTTCTTGG + Intergenic
956068269 3:65419778-65419800 TGGGACACATACAGTTTTCTTGG + Intronic
956877339 3:73476554-73476576 TTGGTCACACACAACAACCTTGG - Intronic
957076735 3:75608645-75608667 ATGCACACCCACTGCTATCTTGG - Intergenic
957482120 3:80811774-80811796 TTGCAAATACACAGCTATATAGG - Intergenic
960742554 3:120851031-120851053 TTGGGCATACACAGCTGACTGGG - Intergenic
961492177 3:127263712-127263734 TTGGAGACACACAGCTGTGGAGG - Intergenic
962443538 3:135444994-135445016 TTGGACACACAAAGCAAACCAGG - Intergenic
967755118 3:193160010-193160032 TTGGACACTCAGAGATATCAGGG + Intergenic
968942593 4:3646521-3646543 GTGGCCAGACTCAGCTATCTGGG + Intergenic
969020188 4:4134940-4134962 ATGCACACCCACTGCTATCTTGG - Intergenic
969733670 4:8972473-8972495 ATGCACACCCACGGCTATCTTGG + Intergenic
971137422 4:23884828-23884850 TTGGATACAGACAGCTTTCTGGG - Exonic
974964580 4:68745539-68745561 TTGGACACGCACAGCTGGCCAGG - Intergenic
976671254 4:87656620-87656642 TGGAACATACACAGCCATCTTGG - Intronic
984906046 4:184626670-184626692 TTGTACACACACAGGTGTATGGG + Intergenic
985047411 4:185953890-185953912 TTGGACACACACAGGTGTGATGG - Intronic
985080250 4:186257796-186257818 TTGCACACACACAGCACTTTGGG + Intronic
987685260 5:21190205-21190227 TTAGAGACCCACAGCTATCTTGG + Intergenic
988136250 5:27175179-27175201 TTGTACAGACACAGTTATCAGGG - Intergenic
996308098 5:122074004-122074026 CTGCACACACACAGGTATGTTGG - Exonic
996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG + Intergenic
998575610 5:143312258-143312280 TTGGCCACACAGACCAATCTTGG - Intronic
998935460 5:147228340-147228362 TTGTACACCCACAGCGATATTGG + Intergenic
1001345645 5:170895820-170895842 TTGGATACACAGAGCTAAATGGG - Intronic
1002272884 5:178084291-178084313 TGGAACACACCCAGCTTTCTTGG - Intergenic
1005816826 6:29559788-29559810 CTGGACAAACACAGCAATCCAGG - Exonic
1006601419 6:35229020-35229042 TTGGCTCCACACAGATATCTTGG + Intronic
1007407469 6:41643291-41643313 CTTGACACACTCAGCCATCTGGG + Intronic
1007697736 6:43744396-43744418 GTGCACACACACAGCCAACTGGG - Intergenic
1008755053 6:54785227-54785249 TTGAACCCACAGAACTATCTGGG - Intergenic
1009996533 6:70901477-70901499 TTTGACACACACACCAATGTGGG - Intronic
1011614895 6:89188839-89188861 TTGCACACACACAGACATCCTGG - Intronic
1014777141 6:125524116-125524138 TTGGTCAGAAACAGCTATCATGG + Intergenic
1018907453 6:168083734-168083756 TGGCAAACACACATCTATCTGGG + Intergenic
1020307601 7:6846969-6846991 ATGCACACCCACTGCTATCTTGG - Intergenic
1022074450 7:26953705-26953727 TTGCACACTCAGAGCTATGTAGG - Intronic
1022415481 7:30173335-30173357 TGGGCCACACACAGCACTCTTGG + Intergenic
1025019670 7:55471139-55471161 TTGGACCCACGCAGTTGTCTTGG + Exonic
1029078719 7:97955913-97955935 ATGCACACCCACTGCTATCTTGG - Intergenic
1032076501 7:128838550-128838572 CTGGACACACACAGCTGCCCCGG - Intronic
1036345213 8:7956671-7956693 ATATACACACACAGCTATCCTGG - Intergenic
1036862345 8:12363683-12363705 ATATACACACACAGCTATCCTGG - Intergenic
1037548954 8:19951162-19951184 TTGCTTAGACACAGCTATCTTGG + Intronic
1039418116 8:37413189-37413211 TTGGAGCCAAACAGCTAACTTGG + Intergenic
1042945063 8:74146117-74146139 TGGGACACACTCAGCTTTTTTGG + Intergenic
1043483844 8:80679410-80679432 TTGGACCCATGCAGCAATCTGGG - Intronic
1044824658 8:96184534-96184556 TTGGACACACACTGAGTTCTAGG - Intergenic
1044827017 8:96208451-96208473 TTGGACACAAACATATATTTTGG + Intergenic
1045257134 8:100535713-100535735 ATGGATACACACAGCTACCCTGG - Intronic
1046587970 8:116170924-116170946 TTTGAAACACATAGCTTTCTTGG - Intergenic
1048314895 8:133354668-133354690 TTGGACACAAACAGGAATCCAGG + Intergenic
1048610716 8:136019763-136019785 TTGGAGACTCAGAGTTATCTGGG + Intergenic
1049522749 8:143102688-143102710 CTGCACACACACACCTCTCTGGG - Intergenic
1050765039 9:9122268-9122290 TTGGAAAGACACACCTATATGGG + Intronic
1050988693 9:12117785-12117807 ATGCACACACACACCTCTCTGGG + Intergenic
1054813304 9:69451814-69451836 TTGTACAAACACTGCAATCTAGG - Intronic
1054920905 9:70541346-70541368 TTGAACACACCCAGCATTCTGGG - Intronic
1056541712 9:87577148-87577170 TTGTACACACACAGCTTCTTAGG - Intronic
1058296659 9:103316190-103316212 GTGAACACACACAGATACCTGGG + Intergenic
1059965665 9:119610998-119611020 TTGGAGACACTCAGGAATCTGGG + Intergenic
1185468509 X:369047-369069 TTCAACACACACAGCTCACTTGG + Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186938163 X:14474081-14474103 TTGTACACACACAGCCACTTAGG - Intergenic
1190193427 X:48296290-48296312 TTGGAAACACACAGCATCCTGGG + Intergenic
1190310774 X:49115750-49115772 TCCGACATACACAGGTATCTGGG + Exonic
1190634848 X:52423784-52423806 TTATACACACACAGCTACCTTGG - Intergenic
1190637337 X:52448945-52448967 TTATAAACACACAGCTACCTAGG + Intergenic
1190648696 X:52547315-52547337 TTATAAACACACAGCTACCTAGG - Intergenic
1190679719 X:52814856-52814878 TTATAAACACACAGCTACCTAGG - Intronic
1192130379 X:68544060-68544082 TTGGCCTCTCACAGCCATCTTGG - Intergenic
1193371269 X:80700101-80700123 TTGGACATACAGAGTTATATAGG - Intronic