ID: 1185619954

View in Genome Browser
Species Human (GRCh38)
Location X:1447857-1447879
Sequence TGGGACACACACTGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 2, 1: 6, 2: 26, 3: 30, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619950_1185619954 -2 Left 1185619950 X:1447836-1447858 CCATCTTGGACACACACCATCTG 0: 3
1: 8
2: 7
3: 28
4: 247
Right 1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG 0: 2
1: 6
2: 26
3: 30
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619954 Original CRISPR TGGGACACACACTGCCATCT TGG Intronic
901638385 1:10680826-10680848 GGGGACACACACTGACTTCCCGG + Intronic
902269092 1:15290219-15290241 TGGGACACACACAACCTTCAGGG + Intronic
904358622 1:29958337-29958359 TGGGACCCACACAGACACCTTGG + Intergenic
905678670 1:39849838-39849860 TGGGAAAGAGACTGCCATCCAGG - Intronic
905915229 1:41679757-41679779 TGGGAAACCCAGTTCCATCTAGG + Intronic
906137567 1:43510266-43510288 TTGGACATCCTCTGCCATCTTGG + Intergenic
907278869 1:53332049-53332071 TGGGACACACAGTGCCGTGGGGG - Intergenic
907700507 1:56782512-56782534 TGGGAAACACAATGTCTTCTAGG - Intronic
910713425 1:90204976-90204998 TGGGAGACTCCCTTCCATCTGGG + Intergenic
916785264 1:168082519-168082541 TGGGACTCCCAATGCCTTCTGGG + Exonic
918109287 1:181441658-181441680 TGGGAGACTCACTGACAACTGGG + Intronic
920490855 1:206413843-206413865 TGGTACACACAGGACCATCTGGG + Intronic
920572943 1:207031680-207031702 TGCCACACAAACTGCCAACTGGG + Intronic
921277330 1:213532904-213532926 TGGGACACACTTTCCCCTCTTGG - Intergenic
921552087 1:216549598-216549620 TGGGGCACATACTGAAATCTTGG - Intronic
1063122584 10:3115211-3115233 TGGGACACACACTTTCACCCTGG - Intronic
1063377268 10:5561810-5561832 TTGGAGTCACTCTGCCATCTTGG - Intergenic
1063715833 10:8526209-8526231 TGAGACTCACTCTGTCATCTAGG + Intergenic
1063922901 10:10949398-10949420 TGGGACACCCAGTGCCATGGTGG + Intergenic
1065233740 10:23625359-23625381 TGAGACCCACACTGGTATCTGGG - Intergenic
1066196670 10:33106823-33106845 TGGCATACACCCTGCCCTCTTGG - Intergenic
1067088587 10:43255318-43255340 TGCCCCACCCACTGCCATCTGGG + Intronic
1068367447 10:56068795-56068817 AGGGATTCACACTACCATCTGGG + Intergenic
1071792232 10:88966986-88967008 TGGCACACAGCCTGCCCTCTTGG - Intronic
1072956772 10:99893795-99893817 TGGGAGATACACTAGCATCTTGG - Intronic
1073034075 10:100550970-100550992 TGTGTCCCACACTGCCAGCTAGG - Exonic
1075178741 10:120190042-120190064 TAGAACTCACACTGCCATCCAGG + Intergenic
1075762094 10:124864719-124864741 TGGGACACACACAGGCCTCAGGG - Intergenic
1081990670 11:47335865-47335887 GGGGACACTCACAGCCCTCTGGG + Exonic
1085326907 11:75613265-75613287 TGGGGCACACACTTGCTTCTCGG + Intronic
1086246734 11:84761755-84761777 TGGGACACAGACTGGCTTCCTGG + Intronic
1086463808 11:87033335-87033357 TGGCAGACACACTGCCTACTTGG + Intergenic
1091399010 12:171631-171653 TGGGGCAGACCCTGCCCTCTTGG + Intronic
1092154501 12:6273708-6273730 TGGGACACCCACTCCCTGCTGGG - Intergenic
1092964046 12:13624742-13624764 TGAGACATCCATTGCCATCTCGG + Intronic
1093034106 12:14316866-14316888 TGGCACTCAAACAGCCATCTGGG + Intergenic
1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG + Intronic
1096749284 12:53748423-53748445 TGGGACCCACTCTGCCTTATGGG - Intergenic
1097432883 12:59530353-59530375 GCGGACACACACTGCGATTTGGG - Intergenic
1098875214 12:75859961-75859983 TAGGCCACACTCTGCCAACTTGG - Intergenic
1099099816 12:78424718-78424740 AGGGTCTCACTCTGCCATCTAGG - Intergenic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1101258710 12:103006936-103006958 TGGGACTCAGACTGGCTTCTTGG - Intergenic
1101578955 12:106024510-106024532 TGGAACTCAAACTGGCATCTTGG + Intergenic
1102717858 12:114989750-114989772 TGGGACTCACACTGGCTTCCTGG - Intergenic
1102737469 12:115175498-115175520 TGGGACTCACACTGGCTTCCTGG - Intergenic
1105026164 12:132850552-132850574 TGGGACACACCCGGTGATCTGGG - Intronic
1106139004 13:26995067-26995089 TGCCACACACACAGCCACCTCGG + Intergenic
1108474267 13:50798403-50798425 TGGGACATACACTGACACCTAGG + Intronic
1108587787 13:51885840-51885862 TGGGACAGAGACTGAAATCTGGG - Intergenic
1111605817 13:90538088-90538110 GGAGACCCACGCTGCCATCTGGG - Intergenic
1117485835 14:56195813-56195835 TGGGGCCCAAACTGCCAGCTGGG - Intronic
1118686428 14:68295886-68295908 TGAGACACACACTGGGATTTGGG - Intronic
1122270017 14:100564826-100564848 TGGGGCTCCCACTGACATCTGGG - Intronic
1125507147 15:40273460-40273482 TGGGACCTACCCTGCCATCGAGG - Exonic
1128186163 15:65645001-65645023 TGGGACAGCCACTGCCATGTGGG + Intronic
1129960848 15:79682487-79682509 TGGGACACAGCCTGCCAAGTAGG + Intergenic
1131081523 15:89540369-89540391 GGGGACACACAGTGGCTTCTAGG + Intergenic
1132698950 16:1214127-1214149 TGGGACACTCACGGCCAGGTTGG - Intronic
1132930669 16:2457516-2457538 TGGGGCACCCACTTCCTTCTGGG + Exonic
1133024225 16:2980678-2980700 TGGGACGCCCACTGCCCTCCAGG + Intergenic
1135425144 16:22328790-22328812 TGGCTCACAGACTGGCATCTGGG - Intronic
1136384574 16:29915257-29915279 TGGCAGAGACACTGCCAGCTTGG - Intronic
1137359208 16:47797654-47797676 TGGGACACAGAGTGCCACATTGG + Intergenic
1139597952 16:67968884-67968906 GGGGAAACACACTTCCACCTCGG + Intronic
1141883950 16:86879104-86879126 TGGGACACTCACGGCCATGGGGG + Intergenic
1142161853 16:88561903-88561925 TGGGACCCCCACTTCCATCATGG - Intergenic
1142311908 16:89319158-89319180 TGGGCCACAGACTCACATCTGGG - Intronic
1143573252 17:7774639-7774661 TGGGGCACAGACTGCCATGAGGG - Intronic
1144476765 17:15595479-15595501 TGGGGCAGACACTACCTTCTTGG + Intronic
1144921478 17:18767870-18767892 TGGGACAGACACTACCTTCTTGG - Intronic
1145007543 17:19346080-19346102 GGGGACCCACACAGCCATCCAGG - Intronic
1145237747 17:21221071-21221093 AGGGCTCCACACTGCCATCTGGG + Intergenic
1145312475 17:21708145-21708167 TGGGGCAGGGACTGCCATCTCGG + Intergenic
1146260771 17:31418878-31418900 TGTGACTCCCACTGCCATCAGGG + Intronic
1147383110 17:40067244-40067266 TGGGACACACCCCACCAGCTAGG + Intronic
1152757657 17:82093727-82093749 AGGAACACACACTGGCGTCTGGG - Exonic
1153225087 18:2893891-2893913 TGGGAGACACACAGTCATCATGG - Intronic
1153307829 18:3648919-3648941 TGGGATGCACACTGTCTTCTGGG + Intronic
1155714185 18:28919555-28919577 TGGGAAATACAATGACATCTTGG + Intergenic
1155824183 18:30418383-30418405 TTTGAGACACACTGCCATTTGGG + Intergenic
1158392715 18:57056686-57056708 TGGGTCTCACTCTGTCATCTAGG - Intergenic
1161038736 19:2099003-2099025 TGGGACACACAGAGCCACCCCGG + Exonic
1161576548 19:5057758-5057780 TGGGACACACCCTGTCCTCAAGG - Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1162094757 19:8303793-8303815 GGGGACACCCACTGCCTGCTGGG - Intronic
1165976319 19:39680005-39680027 TGGGACACACACTGACACATGGG - Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
925919093 2:8627259-8627281 TGGGTCACTCACTGCAAGCTGGG - Intergenic
926497744 2:13612508-13612530 AGGGTCACACTCTGTCATCTAGG - Intergenic
927032281 2:19133647-19133669 TGGGTCATAGACTGACATCTAGG + Intergenic
928100939 2:28437083-28437105 TGGGATCCACGCTGCCACCTCGG - Intergenic
929445605 2:41998489-41998511 TGGGAGTCACATTTCCATCTAGG + Intergenic
929551453 2:42895704-42895726 TGTGACACACAATGCCACCCAGG - Intergenic
930154629 2:48093434-48093456 AGAAACACACACTGCCAGCTGGG - Intergenic
932912804 2:75822206-75822228 TGTCACATACCCTGCCATCTGGG - Intergenic
935746835 2:106196215-106196237 TGGGACACCAACCGCCTTCTGGG - Intergenic
936893594 2:117401156-117401178 TGTGACACACACTGTGATCTGGG + Intergenic
938022962 2:127921179-127921201 GGGGTCTCACTCTGCCATCTAGG + Intergenic
940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG + Intergenic
943654064 2:190488658-190488680 AGTGACACACGCGGCCATCTGGG + Exonic
943764100 2:191641898-191641920 TGGGAAAGAAACTGGCATCTGGG - Intergenic
944663292 2:201938918-201938940 TGGAACAGAGACCGCCATCTCGG + Intergenic
944876605 2:203968854-203968876 GGGGAGACACAGTGCCACCTGGG - Intergenic
946479836 2:220044483-220044505 TGGTGCACACTCAGCCATCTGGG - Intergenic
947825157 2:233100767-233100789 TGGGGCCCACCCTGCCCTCTGGG - Intronic
948855850 2:240730238-240730260 TGGGACCCACATTGCCAGTTGGG + Intronic
948897741 2:240935106-240935128 TGGGAGACCCACAGCCACCTGGG - Intronic
1170836339 20:19887929-19887951 TGGGAGCCACACTGTCACCTTGG - Intronic
1174399911 20:50270368-50270390 TGGGACACCCACCGTCATCCAGG - Intergenic
1177858722 21:26427934-26427956 AGGGTCTCACTCTGCCATCTAGG - Intergenic
1179294918 21:40053247-40053269 TGGGATACTCACAGACATCTTGG - Intronic
1180093643 21:45544483-45544505 TGGGAGTGACACTGGCATCTGGG + Intergenic
1180720824 22:17907157-17907179 AGGGAGACACAAGGCCATCTCGG + Intronic
1181339502 22:22166507-22166529 AGGGACACACACAGCAATCCTGG - Intergenic
1181603385 22:23965542-23965564 TGGGTCTCACTCTGTCATCTAGG + Intergenic
1181605129 22:23975765-23975787 TGGGTCTCACTCTGTCATCTAGG - Intronic
1181720826 22:24773133-24773155 TGGGCCACACATTGGCAGCTGGG + Intronic
1181788170 22:25242684-25242706 TTGGACAGAAACTGCTATCTCGG - Intergenic
1182026483 22:27123190-27123212 TGGGACACAGACTCAGATCTGGG + Intergenic
1182475319 22:30573908-30573930 TGGGACAAACCCTGGCATCCAGG - Intronic
1183376778 22:37469886-37469908 AGGGACCCACAGTGCCACCTTGG + Exonic
1184785544 22:46669959-46669981 TGGGCCACACACTGGCATGTGGG + Intronic
1185105953 22:48869967-48869989 TGGTGCACACGCAGCCATCTTGG + Intergenic
950460015 3:13115615-13115637 AGGGGCACACACTGGCACCTGGG + Intergenic
955412056 3:58662056-58662078 TGGGGCACAAACTGGCCTCTGGG - Intronic
956974052 3:74559580-74559602 TGAGACACACACAACCAACTTGG + Intergenic
960593906 3:119391063-119391085 TCCAACCCACACTGCCATCTTGG - Intronic
961357090 3:126346083-126346105 TGTGACACACACACCCATCCAGG - Intronic
961564852 3:127756109-127756131 TGGAACTCTCACAGCCATCTTGG + Intronic
963110885 3:141686977-141686999 TGGGTCACATACTGACCTCTTGG + Intergenic
964225975 3:154402388-154402410 AGGGTCTCACTCTGCCATCTAGG - Intronic
964601543 3:158506336-158506358 TGTGACACATACTCCCATCTCGG - Intronic
965658747 3:171018415-171018437 TGGGAGACACAAGGCCATCCTGG - Intronic
965779697 3:172271866-172271888 AAGGATAGACACTGCCATCTTGG + Intronic
967863906 3:194174924-194174946 AGGGACTCACTCTGCCATCCAGG + Intergenic
969590304 4:8118229-8118251 TTGCACACTGACTGCCATCTGGG + Intronic
970656273 4:18234010-18234032 TGGGATCCTCATTGCCATCTGGG - Intergenic
976671254 4:87656620-87656642 TGGAACATACACAGCCATCTTGG - Intronic
978972552 4:114827846-114827868 TGGGACAGCCTCTGCCATCGTGG - Exonic
979482071 4:121230867-121230889 TGGGACAAACATTGCCAGGTTGG - Intergenic
980062507 4:128146999-128147021 TGGGATAGACACTGTCATCAAGG - Intronic
981502567 4:145468066-145468088 TGGGACAGAGTCTGCCACCTAGG + Intergenic
981799818 4:148642435-148642457 TGGGAATCTCTCTGCCATCTTGG + Intergenic
982448220 4:155519995-155520017 TTGCACAAACAGTGCCATCTAGG - Intergenic
986181072 5:5393418-5393440 TGGGACTCAGACTGGCTTCTTGG - Intergenic
987707057 5:21471102-21471124 TGGGACTCAGACTGGCTTCTTGG + Intergenic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
989639473 5:43569199-43569221 TGGGACACAATCTCCCAGCTGGG - Intergenic
991767688 5:70004957-70004979 TGGAACACTCACCGCCATCACGG + Intergenic
991846922 5:70880033-70880055 TGGAACACTCACCGCCATCACGG + Intergenic
994569782 5:101501690-101501712 TGAGTCACACACTGTCATCCAGG - Intergenic
995710610 5:115031720-115031742 CAGGGCACTCACTGCCATCTGGG + Intergenic
996002533 5:118381824-118381846 TGTGCCACACAGTGCCATTTTGG - Intergenic
996615522 5:125436565-125436587 TGGCAGAAACACTGCCAGCTTGG - Intergenic
997704608 5:135936229-135936251 TGGGACATACACTGCTTCCTTGG + Intronic
999969006 5:156840190-156840212 TGGGACACACGTTGAAATCTAGG + Intergenic
1000064398 5:157682600-157682622 AGGGACACACACAGCCTTCCAGG - Intergenic
1001982560 5:176046901-176046923 TGGGACCTACACAGCCACCTGGG - Intergenic
1002234901 5:177797156-177797178 TGGGACCTACACAGCCACCTGGG + Intergenic
1003583587 6:7365343-7365365 AGGGTCACACACTGGCATCATGG - Intronic
1004320234 6:14626207-14626229 TGTCACACCCACTGCCTTCTGGG + Intergenic
1009021167 6:57949406-57949428 TGGGACTCAGACTGGCTTCTTGG - Intergenic
1009584080 6:65574042-65574064 AGGGACTCCCACTGCCATGTTGG - Intronic
1011221768 6:85062109-85062131 TGCGACACACAAAGCCATTTTGG - Intergenic
1012653399 6:101785310-101785332 TGGGACACAAAAAGCCATATGGG - Intronic
1012914587 6:105155890-105155912 TTGGCCACACATTGCCATCATGG - Intergenic
1014431757 6:121379474-121379496 AGGGTCTCACTCTGCCATCTAGG + Intergenic
1015220157 6:130795323-130795345 AGAGACACACACTGCTCTCTGGG - Intergenic
1015711469 6:136146083-136146105 TTGGTCACTCACTGCCATCAGGG + Intronic
1017328930 6:153172973-153172995 TGTGACAATCACAGCCATCTGGG - Intergenic
1019491440 7:1315324-1315346 TGGGGCTCAGACTCCCATCTGGG - Intergenic
1019752834 7:2743246-2743268 TGAGACCCAAACTGCCAACTTGG - Intronic
1022415481 7:30173335-30173357 TGGGCCACACACAGCACTCTTGG + Intergenic
1023266364 7:38410366-38410388 CAGGCCCCACACTGCCATCTGGG - Intronic
1026972050 7:74474412-74474434 TGGGAGAGCCACTCCCATCTTGG + Intronic
1028684521 7:93576311-93576333 TGAGTCACACACAGCCCTCTGGG - Intergenic
1028941039 7:96522359-96522381 TAGGACACAAACTGCCAAATAGG - Intronic
1030339984 7:108366664-108366686 TGGGACACTCACTGCCTGCCAGG - Intronic
1030641385 7:112010461-112010483 TGTGACACACATAGCCACCTGGG - Intronic
1031003604 7:116446660-116446682 TGAGAAAAAAACTGCCATCTAGG - Intronic
1041959619 8:63597792-63597814 TGGGGCATACTCTGCCACCTTGG - Intergenic
1043252926 8:78098456-78098478 TTGGACCCTCACTGACATCTAGG + Intergenic
1044423525 8:92025580-92025602 TGGGACAAACCCGGCCAGCTGGG - Intronic
1044824658 8:96184534-96184556 TTGGACACACACTGAGTTCTAGG - Intergenic
1046082721 8:109391560-109391582 TGGGAGACACTATGACATCTTGG - Intronic
1047729403 8:127714503-127714525 TGTGACACACACTGCAAAATTGG + Intergenic
1049054225 8:140222276-140222298 GGAGCCACACTCTGCCATCTGGG + Intronic
1049504113 8:142985735-142985757 TGGGACACACCCTGCCCTCCTGG + Intergenic
1051471409 9:17447093-17447115 TGGGCAACTCACTGCCATCAGGG + Intronic
1051690987 9:19712072-19712094 TGAGACACCTACTGACATCTTGG - Intronic
1052970610 9:34375146-34375168 AGAGACAGACACTGGCATCTGGG - Intronic
1053433310 9:38058307-38058329 TGGGACACTCTCTGCCCTCTGGG - Intronic
1054813304 9:69451814-69451836 TTGTACAAACACTGCAATCTAGG - Intronic
1057287762 9:93774223-93774245 CAGCACAGACACTGCCATCTTGG + Intergenic
1057304320 9:93903544-93903566 TGGGCTCCACACTCCCATCTTGG - Intergenic
1057525220 9:95793242-95793264 TGGGTCTCACACTGCCACCCAGG + Intergenic
1058952182 9:109914219-109914241 TGAGGCACAAACTGCCATCTTGG - Intronic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG + Intergenic
1062082494 9:134631634-134631656 TGGGACTCACACTGGCTTCCTGG + Intergenic
1062711306 9:137976522-137976544 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711323 9:137976619-137976641 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711340 9:137976717-137976739 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711356 9:137976814-137976836 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711371 9:137976911-137976933 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711388 9:137977008-137977030 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711403 9:137977105-137977127 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711421 9:137977202-137977224 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711436 9:137977299-137977321 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711454 9:137977396-137977418 TGGGAAACACACTGCCTCCAAGG - Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619214 X:1443093-1443115 TGGGACACACACCGTCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1190250140 X:48717137-48717159 TGGGACACACACCACCAAATAGG + Intergenic
1193873379 X:86829841-86829863 AGGGACACACACTGACATTTGGG - Intronic
1194379643 X:93177196-93177218 TGGGAGTCACACTGCCTTCCTGG + Intergenic
1197614444 X:128675685-128675707 TGGGACACACCCTGGCTTCCAGG - Intergenic
1197702692 X:129611290-129611312 TGTGCCACACACTGTCTTCTAGG + Intergenic
1199685060 X:150258279-150258301 TGAGACAGACACAGCCTTCTTGG + Intergenic