ID: 1185619960

View in Genome Browser
Species Human (GRCh38)
Location X:1447895-1447917
Sequence TTGGACAAGCACCGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619953_1185619960 20 Left 1185619953 X:1447852-1447874 CCATCTGGGACACACACTGCCAT No data
Right 1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG No data
1185619955_1185619960 1 Left 1185619955 X:1447871-1447893 CCATCTTGGACCCATAACACCAT No data
Right 1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG No data
1185619958_1185619960 -10 Left 1185619958 X:1447882-1447904 CCATAACACCATCTTGGACAAGC No data
Right 1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG No data
1185619957_1185619960 -9 Left 1185619957 X:1447881-1447903 CCCATAACACCATCTTGGACAAG No data
Right 1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619960 Original CRISPR TTGGACAAGCACCGCCATCT TGG Intronic