ID: 1185619960

View in Genome Browser
Species Human (GRCh38)
Location X:1447895-1447917
Sequence TTGGACAAGCACCGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 3, 2: 41, 3: 25, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619958_1185619960 -10 Left 1185619958 X:1447882-1447904 CCATAACACCATCTTGGACAAGC 0: 2
1: 0
2: 1
3: 9
4: 89
Right 1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG 0: 1
1: 3
2: 41
3: 25
4: 82
1185619953_1185619960 20 Left 1185619953 X:1447852-1447874 CCATCTGGGACACACACTGCCAT 0: 2
1: 5
2: 38
3: 80
4: 311
Right 1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG 0: 1
1: 3
2: 41
3: 25
4: 82
1185619955_1185619960 1 Left 1185619955 X:1447871-1447893 CCATCTTGGACCCATAACACCAT 0: 2
1: 1
2: 2
3: 18
4: 172
Right 1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG 0: 1
1: 3
2: 41
3: 25
4: 82
1185619957_1185619960 -9 Left 1185619957 X:1447881-1447903 CCCATAACACCATCTTGGACAAG 0: 2
1: 0
2: 1
3: 8
4: 124
Right 1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG 0: 1
1: 3
2: 41
3: 25
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619960 Original CRISPR TTGGACAAGCACCGCCATCT TGG Intronic
906137567 1:43510266-43510288 TTGGACATCCTCTGCCATCTTGG + Intergenic
908647947 1:66300036-66300058 TTGCACAAACACAGACATCTAGG + Intronic
913016542 1:114742379-114742401 TGGGACAAGCACGGCCAACATGG + Intronic
1063123607 10:3122185-3122207 TTGGCCAGGCACAGCCACCTTGG + Intronic
1066261059 10:33730155-33730177 GTGGACAAGCACTGGTATCTTGG + Intergenic
1070070145 10:73080288-73080310 TTTGAGAAGCACTGCCATATAGG - Intronic
1073290723 10:102412010-102412032 TTGGCCATGCCCAGCCATCTTGG + Intronic
1081059941 11:38461876-38461898 TTGGAAACGCACACCCATCTGGG - Intergenic
1092033612 12:5311078-5311100 TTGGGCAATCACCTCCACCTAGG + Intergenic
1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG + Intronic
1097429985 12:59493666-59493688 TTGAGCAAGCACTGCAATCTCGG + Intergenic
1108355456 13:49625475-49625497 TGAGACAGGCACCGCCATCAAGG - Intergenic
1108526126 13:51287510-51287532 TTGGAGAAGCCCAGCCCTCTAGG - Intergenic
1133921647 16:10158827-10158849 TGTGACCAGCACCTCCATCTAGG - Intronic
1134100340 16:11447590-11447612 TAGGACGAGCAGAGCCATCTTGG - Intronic
1144032874 17:11337665-11337687 CTGGCCAAGCAAAGCCATCTTGG - Intronic
1149948715 17:60960819-60960841 CTGCAGAAACACCGCCATCTTGG - Intronic
1153589804 18:6661569-6661591 CTGGACAAGAAAAGCCATCTGGG + Intergenic
1158259326 18:55589913-55589935 GTCGACCAGCACCGCCATCTTGG - Intronic
1162443595 19:10708531-10708553 TTTGACAAGCACCGCCCCATGGG + Intronic
1168057050 19:53869701-53869723 TTGGACAGGCTCCTCCCTCTAGG - Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
936523729 2:113228764-113228786 TTGGACAAGCAGTGCCATAGAGG - Intronic
943409504 2:187529384-187529406 TTGGACCAGCACCTTGATCTTGG - Intronic
1182261885 22:29079044-29079066 TGAGGGAAGCACCGCCATCTTGG - Intronic
961495285 3:127287148-127287170 TGGGACCACCACCTCCATCTGGG - Intergenic
967600542 3:191382420-191382442 GTGGCCAAGCACACCCATCTAGG + Intronic
969583826 4:8080730-8080752 TTGGACAAGCACTGGCACTTGGG - Exonic
969639232 4:8387119-8387141 TTGGACAGGAACCGCCCTCGAGG - Intronic
970207762 4:13672709-13672731 ATGGAAAAGCAGCGCCATCAGGG + Intergenic
982448220 4:155519995-155520017 TTGCACAAACAGTGCCATCTAGG - Intergenic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
990417211 5:55597939-55597961 TTGGGCCAGCCCCACCATCTGGG - Intergenic
992371227 5:76146176-76146198 TTGGACAAGAGCAGCCATGTAGG + Intronic
995835374 5:116395294-116395316 CTGGACAAGCTCCGCCATTCAGG - Intronic
997661898 5:135595403-135595425 ATGGACAGGCACCGCCAACCAGG + Intergenic
1006439566 6:34045519-34045541 TTGGACAACCAAAGACATCTGGG - Intronic
1007628962 6:43262260-43262282 TGGGACTAGCAAGGCCATCTTGG + Intronic
1009369202 6:62879885-62879907 TTGTACAACCACCGCAATATTGG - Intergenic
1017328930 6:153172973-153172995 TGTGACAATCACAGCCATCTGGG - Intergenic
1019655626 7:2193335-2193357 TAGGACAAGGACCGTCCTCTGGG - Intronic
1030607125 7:111649729-111649751 TTAGACAAGCCCAGCCACCTAGG + Intergenic
1031439170 7:121772107-121772129 TTGGAGAAGCAGTGCCATATTGG - Intergenic
1032760749 7:134939186-134939208 TTGGGCAAGGACAGCCATCAGGG + Intronic
1037431609 8:18819010-18819032 CTGGACAAGCACCTACCTCTAGG + Intronic
1041087716 8:54272015-54272037 ATGGACAACAACCTCCATCTCGG + Intergenic
1043557309 8:81446507-81446529 TTTGACAAGCACAGCAAACTCGG + Intronic
1043613859 8:82101201-82101223 TTGGAAAAGCATCTTCATCTAGG + Intergenic
1047138467 8:122107720-122107742 TTGGGCAAGCCCTGCCATCATGG - Intergenic
1047252228 8:123189375-123189397 TTTTAAAACCACCGCCATCTGGG - Intronic
1054813304 9:69451814-69451836 TTGTACAAACACTGCAATCTAGG - Intronic
1054969251 9:71065965-71065987 CTGAACCAGCACAGCCATCTGGG + Intronic
1057373100 9:94491713-94491735 TTGGACAAGCAACAACACCTGGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619982 X:1448042-1448064 TTGGATAAGAACCACCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1187667834 X:21633896-21633918 TTGGACCAGCAAAGTCATCTTGG - Intronic
1190949304 X:55127250-55127272 TGTGACTAGCACAGCCATCTTGG - Intronic
1191741195 X:64436823-64436845 ATGGACAAGCATCCTCATCTTGG + Intergenic