ID: 1185619964

View in Genome Browser
Species Human (GRCh38)
Location X:1447923-1447945
Sequence GTGTTGTGTATCCAAGATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619964_1185619968 4 Left 1185619964 X:1447923-1447945 CCGCCATCTTGGATACACAACAC No data
Right 1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG No data
1185619964_1185619971 23 Left 1185619964 X:1447923-1447945 CCGCCATCTTGGATACACAACAC No data
Right 1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619964 Original CRISPR GTGTTGTGTATCCAAGATGG CGG (reversed) Intronic