ID: 1185619965

View in Genome Browser
Species Human (GRCh38)
Location X:1447926-1447948
Sequence ATGGTGTTGTGTATCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619965_1185619968 1 Left 1185619965 X:1447926-1447948 CCATCTTGGATACACAACACCAT No data
Right 1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG No data
1185619965_1185619971 20 Left 1185619965 X:1447926-1447948 CCATCTTGGATACACAACACCAT No data
Right 1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619965 Original CRISPR ATGGTGTTGTGTATCCAAGA TGG (reversed) Intronic