ID: 1185619966

View in Genome Browser
Species Human (GRCh38)
Location X:1447931-1447953
Sequence TTGGATACACAACACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 1, 2: 1, 3: 52, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619962_1185619966 -1 Left 1185619962 X:1447909-1447931 CCATCTTGGACACACCGCCATCT 0: 2
1: 0
2: 1
3: 5
4: 115
Right 1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG 0: 1
1: 1
2: 1
3: 52
4: 134
1185619957_1185619966 27 Left 1185619957 X:1447881-1447903 CCCATAACACCATCTTGGACAAG 0: 2
1: 0
2: 1
3: 8
4: 124
Right 1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG 0: 1
1: 1
2: 1
3: 52
4: 134
1185619959_1185619966 18 Left 1185619959 X:1447890-1447912 CCATCTTGGACAAGCACCGCCAT 0: 9
1: 48
2: 115
3: 80
4: 141
Right 1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG 0: 1
1: 1
2: 1
3: 52
4: 134
1185619958_1185619966 26 Left 1185619958 X:1447882-1447904 CCATAACACCATCTTGGACAAGC 0: 2
1: 0
2: 1
3: 9
4: 89
Right 1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG 0: 1
1: 1
2: 1
3: 52
4: 134
1185619961_1185619966 2 Left 1185619961 X:1447906-1447928 CCGCCATCTTGGACACACCGCCA 0: 2
1: 0
2: 1
3: 6
4: 125
Right 1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG 0: 1
1: 1
2: 1
3: 52
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619966 Original CRISPR TTGGATACACAACACCATCT TGG Intronic
906379709 1:45324772-45324794 TAGGCCACACAACACCTTCTGGG + Intergenic
907333131 1:53684291-53684313 ATAAATACACAACACCTTCTGGG - Intronic
910658764 1:89647234-89647256 TTTGATACATAATAGCATCTAGG - Intronic
911627733 1:100145174-100145196 TAGGCTACACTACACCATCTAGG + Intronic
911892050 1:103383708-103383730 TTGTATACATAACAACATATGGG - Intergenic
915843035 1:159232331-159232353 TTGTAAACACAAGACCATGTCGG - Intergenic
916788148 1:168101384-168101406 TAGGATATACAACAGCATCCTGG - Intronic
922012509 1:221604891-221604913 TAGGCTACACTACACCATCTTGG - Intergenic
922064932 1:222127448-222127470 TTGAATGCACAACACCCTGTAGG - Intergenic
1067249343 10:44574120-44574142 TGGGAAACACCACAGCATCTGGG + Intergenic
1077821253 11:5743635-5743657 TTGGATACACAACAAAATCAAGG + Intronic
1077970188 11:7181376-7181398 AGGGGTACACAACACCAGCTGGG + Intergenic
1078352549 11:10606440-10606462 TTAGATACACAAAACCAGCTGGG - Intronic
1078587875 11:12609872-12609894 TTGAATACACAACCCCATGGGGG + Intergenic
1079739609 11:24040575-24040597 TTAGAAACACAAAACAATCTGGG + Intergenic
1081085299 11:38792108-38792130 AGGGACAGACAACACCATCTAGG + Intergenic
1082044825 11:47716318-47716340 TTGATCACACAGCACCATCTGGG + Intergenic
1089729339 11:120511049-120511071 TTGTATACATACCAACATCTTGG - Intergenic
1095128161 12:38506847-38506869 TGGGAAACACAACTCCATATAGG - Intergenic
1098979110 12:76935937-76935959 TTGGCCAGACAAGACCATCTAGG - Intergenic
1103503012 12:121419512-121419534 TTGGGTATACACCACCATTTGGG + Intronic
1105640682 13:22260626-22260648 TTCTATACATAACACCATATAGG - Intergenic
1106009324 13:25803170-25803192 TTGGATACAGAACCACATTTTGG + Intronic
1106257612 13:28035967-28035989 ATGGATACCCATTACCATCTTGG - Exonic
1106450323 13:29875614-29875636 TTTGATTTACAACACCAACTTGG + Intergenic
1106879254 13:34111537-34111559 TTGGATAAACAAAAGGATCTGGG - Intergenic
1107215577 13:37914497-37914519 TTGGATTCAGATTACCATCTGGG + Intergenic
1111038901 13:82718034-82718056 TTGGATACAGAAAATCATGTAGG + Intergenic
1111245678 13:85536765-85536787 TAGGTTACACCACACAATCTAGG + Intergenic
1111527567 13:89492215-89492237 ATGTAGACACAACACCAGCTGGG - Intergenic
1114757264 14:25273634-25273656 TTCGTTACACAAAACCATTTGGG + Intergenic
1115196016 14:30800143-30800165 TTCTATACCCAACACCATCAGGG - Intergenic
1117078366 14:52126716-52126738 TTGGAAACCCAACAGCATTTAGG + Intergenic
1118930646 14:70237045-70237067 TTGCATATACAACACCATGTAGG + Intergenic
1118954215 14:70465209-70465231 TTGCGTATACAACACCATGTAGG - Intergenic
1119477807 14:74941274-74941296 TTGGAAACAAAACTACATCTTGG + Intergenic
1120547940 14:85832904-85832926 TTGGATACACATAAACACCTGGG + Intergenic
1121269090 14:92625992-92626014 TTGGATCCAGAAGACCCTCTTGG - Intronic
1122357176 14:101130808-101130830 TTGGATACTCAGCACCAACCGGG - Intergenic
1125709314 15:41771959-41771981 GTGGTTAAGCAACACCATCTAGG - Intronic
1126728916 15:51661634-51661656 TGGGAAACACAACATCCTCTAGG + Intergenic
1127545805 15:59993758-59993780 TGGGAAACAGAACACCTTCTGGG - Intergenic
1128285925 15:66436996-66437018 TGGGATCCACATCACTATCTGGG + Intronic
1128911002 15:71514867-71514889 TTGGATACATAACATCCTATGGG + Intronic
1131655319 15:94451004-94451026 TTGGATACCCAACGCCAACAAGG + Intronic
1135340823 16:21646570-21646592 TTGGTTAAACATCACCATGTAGG + Intronic
1136589610 16:31209856-31209878 GTGGATAAATAACACCATCCTGG - Intergenic
1142333011 16:89467700-89467722 TTAGATTCACAACAGCATTTGGG - Intronic
1151063887 17:71128827-71128849 TTGGAGACACCACAAAATCTTGG - Intergenic
1151381390 17:73728128-73728150 TTAGATGCACAGCACCAGCTGGG - Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
929719334 2:44351400-44351422 TTGGATATACAAGTTCATCTTGG - Intronic
933700976 2:85255370-85255392 TTGGAAACACAACAGCATGTAGG - Intronic
937858130 2:126687415-126687437 CTGGATACACAGCATCCTCTGGG - Intronic
939772590 2:146340282-146340304 TTGGCTATAAAACAACATCTGGG - Intergenic
942577299 2:177377706-177377728 TTGCACACATAACCCCATCTGGG + Intronic
942782217 2:179657663-179657685 TTGGATTCACAACACTTTCTAGG - Intronic
947536687 2:230944121-230944143 TTACACACACAACAGCATCTTGG + Intronic
1168970993 20:1930533-1930555 GTGGCTACACAGCCCCATCTAGG + Intronic
1169134041 20:3185650-3185672 AAGGATACACAAGGCCATCTAGG + Intergenic
1176951421 21:15051520-15051542 TTTGATTCACAAGTCCATCTAGG + Intronic
1179082652 21:38187410-38187432 TTGGATACCCAACATCAGCCAGG - Intronic
951662340 3:25082930-25082952 TTGGATATACAGCTCCAGCTTGG + Intergenic
952521900 3:34169328-34169350 CAGCATACAAAACACCATCTTGG - Intergenic
954824782 3:53363090-53363112 TTGAATAGACAAAACAATCTTGG + Intergenic
955611246 3:60759619-60759641 TTGGGGACACCACACCCTCTTGG - Intronic
955977493 3:64492339-64492361 TTGCATACACCACCCCAGCTTGG + Intergenic
957607102 3:82415250-82415272 TAGGTTACCCAAGACCATCTAGG - Intergenic
968569045 4:1329767-1329789 AGTGATACACAACACCCTCTGGG - Intronic
972583015 4:40411896-40411918 CTGCAAACACAGCACCATCTTGG - Intergenic
974408374 4:61506328-61506350 TTTAAAATACAACACCATCTTGG + Intronic
974410545 4:61536120-61536142 TTGGATAAACAACAACATTAAGG - Intronic
976901814 4:90186847-90186869 TTGGTTACACTACACCATGGGGG - Intronic
977836894 4:101655864-101655886 TTAGATACACACCACAATATAGG - Intronic
977861442 4:101965536-101965558 TTTGTTACAAAACAGCATCTTGG + Intronic
978024967 4:103862297-103862319 TTGGATACACACCAAGAACTGGG + Intergenic
980493873 4:133566296-133566318 TTAGACACACAACAACAGCTGGG + Intergenic
984184983 4:176532891-176532913 TTGGATACAAAACACTATGATGG - Intergenic
984476607 4:180243191-180243213 TGGGCTGCACAACACCAACTGGG + Intergenic
986773054 5:10990635-10990657 TTTAATAAACACCACCATCTGGG - Intronic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
990661973 5:58025916-58025938 TTGTGTACAGAACTCCATCTGGG - Intergenic
990843983 5:60116255-60116277 TCACATGCACAACACCATCTAGG - Intronic
990976449 5:61565517-61565539 TTGGATACTCACCACTACCTGGG + Intergenic
996009317 5:118463681-118463703 TTGGAATCTCAACACCATTTTGG + Intergenic
996316694 5:122168416-122168438 TTTTATACACTAAACCATCTTGG - Intronic
997117790 5:131144613-131144635 TAAAATACACAACATCATCTAGG - Intergenic
1000571421 5:162918866-162918888 GTGGATAACCAACACCATTTTGG + Intergenic
1005706075 6:28454838-28454860 TTGGAGACACAGCACCATTTAGG + Intergenic
1005860531 6:29896667-29896689 TGGGATCCACTACCCCATCTCGG + Intergenic
1011335027 6:86250780-86250802 CTGGCTACACAAAACCAACTGGG + Intergenic
1016489842 6:144587126-144587148 TGGTATACACAACACGATTTTGG + Intronic
1020712982 7:11631804-11631826 TTAGATAAGCAACACCATTTTGG + Intronic
1020713197 7:11635341-11635363 TTGGATAAACCAGACCATCTGGG - Intronic
1026261765 7:68761592-68761614 TTGAGTACACAATGCCATCTTGG + Intergenic
1030146071 7:106357374-106357396 TTGGATACACAACAGCAACTTGG + Intergenic
1030941699 7:115658779-115658801 TAGGATAAACAAAACCATGTTGG - Intergenic
1030946958 7:115735254-115735276 TTGGGTACACAACCCCATTCTGG + Intergenic
1031488169 7:122354863-122354885 TTGGCTAGACAACCCTATCTTGG - Intronic
1037173000 8:15916036-15916058 TTGGATAAACAAAACACTCTTGG + Intergenic
1042065406 8:64869536-64869558 TTGGACACATAACTCCACCTGGG + Intergenic
1044585788 8:93868324-93868346 TTGGACAGCCAACACCATTTTGG - Intronic
1045230559 8:100302499-100302521 TTGGATATACATCTCCACCTAGG - Intronic
1046777705 8:118181253-118181275 TTGGATTCACAATAACATCTTGG + Intergenic
1054997287 9:71407047-71407069 TAGGAAACATAAAACCATCTAGG - Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619872 X:1447289-1447311 TTGGACCCATTACACCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619956 X:1447876-1447898 TTGGACCCATAACACCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619982 X:1448042-1448064 TTGGATAAGAACCACCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620025 X:1448350-1448372 TTGGACCCATAACACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1185786363 X:2894613-2894635 TTGCTTAAACAACACCATCCAGG + Intergenic
1186644368 X:11490635-11490657 TTGAAATCACAGCACCATCTGGG - Intronic
1187058911 X:15767149-15767171 TTGAATTCTCAACCCCATCTAGG + Intronic
1187075491 X:15930200-15930222 TTGGCCACACAAAACCACCTGGG - Intergenic
1188958008 X:36457009-36457031 TTGGATAAACAACAACATGAAGG + Intergenic
1193568711 X:83114034-83114056 TGGGATACACCACACATTCTGGG + Intergenic
1196286162 X:113882801-113882823 TTGCTTAGACAATACCATCTGGG + Intergenic
1197166100 X:123379319-123379341 TTGGACACACAAAACCCTCATGG - Intronic
1199006611 X:142706373-142706395 TTTCATACACAACACGAACTTGG - Intergenic
1201902548 Y:19058256-19058278 TGGGATACACAACAGCATTTGGG - Intergenic