ID: 1185619967

View in Genome Browser
Species Human (GRCh38)
Location X:1447945-1447967
Sequence ATGGTGGTGCTTTTCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619967_1185619974 20 Left 1185619967 X:1447945-1447967 CCATCTTGGAAAAGCACCACCAT No data
Right 1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG No data
1185619967_1185619971 1 Left 1185619967 X:1447945-1447967 CCATCTTGGAAAAGCACCACCAT No data
Right 1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619967 Original CRISPR ATGGTGGTGCTTTTCCAAGA TGG (reversed) Intronic