ID: 1185619969

View in Genome Browser
Species Human (GRCh38)
Location X:1447961-1447983
Sequence GCGGTGTGTGTCCAAGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619969_1185619977 20 Left 1185619969 X:1447961-1447983 CCACCATCTTGGACACACACCGC No data
Right 1185619977 X:1448004-1448026 ATCTTGGACACACACCATCTTGG No data
1185619969_1185619974 4 Left 1185619969 X:1447961-1447983 CCACCATCTTGGACACACACCGC No data
Right 1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619969 Original CRISPR GCGGTGTGTGTCCAAGATGG TGG (reversed) Intronic