ID: 1185619970

View in Genome Browser
Species Human (GRCh38)
Location X:1447964-1447986
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619970_1185619974 1 Left 1185619970 X:1447964-1447986 CCATCTTGGACACACACCGCCAT No data
Right 1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG No data
1185619970_1185619977 17 Left 1185619970 X:1447964-1447986 CCATCTTGGACACACACCGCCAT No data
Right 1185619977 X:1448004-1448026 ATCTTGGACACACACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619970 Original CRISPR ATGGCGGTGTGTGTCCAAGA TGG (reversed) Intronic