ID: 1185619974

View in Genome Browser
Species Human (GRCh38)
Location X:1447988-1448010
Sequence TTGGATAAGAACCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619970_1185619974 1 Left 1185619970 X:1447964-1447986 CCATCTTGGACACACACCGCCAT No data
Right 1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG No data
1185619967_1185619974 20 Left 1185619967 X:1447945-1447967 CCATCTTGGAAAAGCACCACCAT No data
Right 1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG No data
1185619969_1185619974 4 Left 1185619969 X:1447961-1447983 CCACCATCTTGGACACACACCGC No data
Right 1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619974 Original CRISPR TTGGATAAGAACCACCATCT TGG Intronic