ID: 1185619987

View in Genome Browser
Species Human (GRCh38)
Location X:1448077-1448099
Sequence TTGGACACACACAGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619980_1185619987 20 Left 1185619980 X:1448034-1448056 CCGCCATCTTGGATAAGAACCAC No data
Right 1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG No data
1185619983_1185619987 1 Left 1185619983 X:1448053-1448075 CCACCATCTTGGACACACACCAT No data
Right 1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG No data
1185619984_1185619987 -2 Left 1185619984 X:1448056-1448078 CCATCTTGGACACACACCATCTT No data
Right 1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG No data
1185619981_1185619987 17 Left 1185619981 X:1448037-1448059 CCATCTTGGATAAGAACCACCAT No data
Right 1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619987 Original CRISPR TTGGACACACACAGCCATCT TGG Intronic