ID: 1185619987

View in Genome Browser
Species Human (GRCh38)
Location X:1448077-1448099
Sequence TTGGACACACACAGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 26, 2: 21, 3: 37, 4: 224}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619983_1185619987 1 Left 1185619983 X:1448053-1448075 CCACCATCTTGGACACACACCAT 0: 10
1: 8
2: 18
3: 47
4: 190
Right 1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG 0: 1
1: 26
2: 21
3: 37
4: 224
1185619984_1185619987 -2 Left 1185619984 X:1448056-1448078 CCATCTTGGACACACACCATCTT 0: 8
1: 9
2: 11
3: 58
4: 284
Right 1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG 0: 1
1: 26
2: 21
3: 37
4: 224
1185619981_1185619987 17 Left 1185619981 X:1448037-1448059 CCATCTTGGATAAGAACCACCAT 0: 2
1: 17
2: 20
3: 61
4: 196
Right 1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG 0: 1
1: 26
2: 21
3: 37
4: 224
1185619980_1185619987 20 Left 1185619980 X:1448034-1448056 CCGCCATCTTGGATAAGAACCAC 0: 2
1: 9
2: 4
3: 14
4: 147
Right 1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG 0: 1
1: 26
2: 21
3: 37
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185619987 Original CRISPR TTGGACACACACAGCCATCT TGG Intronic
901383915 1:8894059-8894081 TTTGACACACATGGCCACCTTGG + Intergenic
902269092 1:15290219-15290241 TGGGACACACACAACCTTCAGGG + Intronic
902576625 1:17381982-17382004 TTGGACATTCAGAGTCATCTGGG - Exonic
903876254 1:26475428-26475450 TTTGACACACATGGCCACCTTGG + Exonic
903902921 1:26661616-26661638 TTGGCCACCCTCAGTCATCTTGG - Intergenic
904358622 1:29958337-29958359 TGGGACCCACACAGACACCTTGG + Intergenic
905318680 1:37099983-37100005 TTTGGAACACACAGACATCTGGG + Intergenic
905451340 1:38058771-38058793 TTGGACACACAAGGACACCTTGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906137567 1:43510266-43510288 TTGGACATCCTCTGCCATCTTGG + Intergenic
907962425 1:59296404-59296426 TCTGACACACACACCCATCAGGG + Intergenic
908647947 1:66300036-66300058 TTGCACAAACACAGACATCTAGG + Intronic
909495976 1:76279163-76279185 TTGGACACACACAGCCAGGCAGG + Intronic
911093443 1:94036275-94036297 TTTGTCACTCAAAGCCATCTAGG + Intronic
911321617 1:96420119-96420141 TTTGTCTCACACAGCCATATAGG + Intergenic
914812438 1:151038749-151038771 TCCAACACACACACCCATCTTGG + Intronic
915336937 1:155149407-155149429 TTTGACACACATGGCCACCTTGG + Intergenic
916801571 1:168221177-168221199 GTGAACACACAAAGCAATCTAGG + Intergenic
918683492 1:187385424-187385446 TTGGAAACAGACAGATATCTTGG - Intergenic
921196234 1:212760383-212760405 GTGCACACACTCAGCCATCAAGG + Intronic
922952544 1:229571084-229571106 TTTGACACACATGGCCACCTTGG + Intergenic
923394683 1:233549897-233549919 TTGGACATAGACAGCCATACAGG + Intergenic
1063123607 10:3122185-3122207 TTGGCCAGGCACAGCCACCTTGG + Intronic
1063377268 10:5561810-5561832 TTGGAGTCACTCTGCCATCTTGG - Intergenic
1063685486 10:8233442-8233464 CTGGGCACACATAGCCATCTAGG + Intergenic
1064006101 10:11700321-11700343 TTGGACACACAGAGACACCAGGG + Intergenic
1072553752 10:96498620-96498642 TTGGCCACAGACAGCTATTTGGG - Intronic
1073290723 10:102412010-102412032 TTGGCCATGCCCAGCCATCTTGG + Intronic
1075192984 10:120328571-120328593 TTGGACATAAACAGCAATCTAGG - Intergenic
1075383146 10:122035065-122035087 TTGGAGACAAGAAGCCATCTTGG + Intronic
1075762094 10:124864719-124864741 TGGGACACACACAGGCCTCAGGG - Intergenic
1081059941 11:38461876-38461898 TTGGAAACGCACACCCATCTGGG - Intergenic
1081751556 11:45514725-45514747 TTTGACACACATAGCCACCTTGG + Intergenic
1081990670 11:47335865-47335887 GGGGACACTCACAGCCCTCTGGG + Exonic
1082855150 11:57799336-57799358 CTGGCCACCCACACCCATCTGGG - Intronic
1082937604 11:58670635-58670657 TTGGACACCCCCAGCGATATGGG + Intronic
1085074736 11:73580791-73580813 TTTGACACACATGGCCACCTTGG + Intronic
1085825122 11:79839110-79839132 TTAGACACTCCCAGACATCTTGG - Intergenic
1092247112 12:6869823-6869845 TTGGACAGACACAGCCCACATGG + Intronic
1093034106 12:14316866-14316888 TGGCACTCAAACAGCCATCTGGG + Intergenic
1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG + Intronic
1096713278 12:53474034-53474056 TTAGACACATACAGGCATTTGGG + Intronic
1098256941 12:68626465-68626487 TTGGACATAGAGAACCATCTTGG + Intronic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1101002663 12:100372317-100372339 TTGGACACACAGAGACACCAGGG - Intronic
1103504212 12:121430330-121430352 CTGGACACTCACAGACATCTCGG + Exonic
1103849493 12:123922760-123922782 TTGGACACACAGAGACACCAGGG - Intronic
1105544945 13:21344480-21344502 TTGTTCACACACAGCCAAGTTGG + Intergenic
1106139004 13:26995067-26995089 TGCCACACACACAGCCACCTCGG + Intergenic
1107651137 13:42546404-42546426 TTGGACACAGACAGGCATGCAGG + Intergenic
1107999095 13:45890151-45890173 CTGGACACACTCAGCCCTTTTGG + Intergenic
1109164068 13:59011258-59011280 TTGACCACACGCAGCCACCTTGG + Intergenic
1113733476 13:112658578-112658600 TTAGAGACTCACAGCCATATTGG + Intronic
1114511289 14:23263609-23263631 TTTGACACACATGGCCACCTTGG - Intronic
1117413390 14:55471003-55471025 TTGGACACACAGACCAATCTTGG + Intergenic
1117941524 14:60971958-60971980 TTTGACACACATGGCCACCTTGG - Exonic
1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG + Intergenic
1119887453 14:78154784-78154806 TTGGCAACACAGAGCCAGCTAGG - Intergenic
1119999425 14:79285635-79285657 TTGGACACACAAAGACACCAGGG - Intronic
1122089493 14:99328769-99328791 CTGGACACAGACAGCCTCCTAGG + Intergenic
1123488373 15:20760954-20760976 CTGGGAACACACAGCCATCAGGG - Intergenic
1123544870 15:21330027-21330049 CTGGGAACACACAGCCATCAGGG - Intergenic
1124445858 15:29731262-29731284 TTTGACACACATGGCCACCTTGG + Intronic
1125452409 15:39823281-39823303 TTGGACTCTCACAATCATCTTGG + Intronic
1129702811 15:77777402-77777424 ATGGACACACACACACAACTGGG + Intronic
1132046615 15:98568063-98568085 TTGCCCACACACAAGCATCTGGG + Intergenic
1132179220 15:99739191-99739213 TTGGATACTGACGGCCATCTGGG - Intergenic
1202953216 15_KI270727v1_random:57298-57320 CTGGGAACACACAGCCATCAGGG - Intergenic
1135858295 16:26032239-26032261 TTTGACACACATGGCCACCTTGG - Intronic
1137062329 16:35802612-35802634 TTTGACACACATGGCCACCTTGG - Intergenic
1138128750 16:54460515-54460537 GTGGACAGACAGAGCCAGCTAGG + Intergenic
1141133881 16:81453337-81453359 ATGGAATCAAACAGCCATCTGGG + Intronic
1144750314 17:17644065-17644087 TTGGACACACACACACATAGAGG + Intergenic
1145007543 17:19346080-19346102 GGGGACCCACACAGCCATCCAGG - Intronic
1146054035 17:29572459-29572481 TTGAACAGACACAGCCCCCTGGG - Exonic
1146728342 17:35173691-35173713 TTGGGCCCACACAGAAATCTAGG + Intronic
1147753567 17:42753233-42753255 TTTGACACACATGGCCACCTTGG - Intergenic
1148107461 17:45127060-45127082 GTGGCCACACACAGCCCTTTGGG - Intronic
1150171824 17:63004404-63004426 TTTGACACACATAGCCACCTTGG - Intergenic
1151578515 17:74964572-74964594 CTGGGCAGACACAGCCACCTCGG - Exonic
1153225087 18:2893891-2893913 TGGGAGACACACAGTCATCATGG - Intronic
1153837498 18:8977094-8977116 TTGGCCACACCCGGCCACCTTGG - Intergenic
1153892282 18:9528832-9528854 TTGGACCCACAGACCAATCTGGG - Intronic
1155824183 18:30418383-30418405 TTTGAGACACACTGCCATTTGGG + Intergenic
1155965677 18:32033245-32033267 TTTGACAAACACAGACACCTTGG - Intronic
1156009186 18:32476265-32476287 GTTGACACACATAGCCACCTTGG - Intergenic
1156588419 18:38458943-38458965 TAGGACACACACACACATATAGG + Intergenic
1158106131 18:53887083-53887105 GTGGACTCACACACCCATATGGG - Intergenic
1161013579 19:1971667-1971689 CAGGACCCACATAGCCATCTGGG - Intronic
1161038736 19:2099003-2099025 TGGGACACACAGAGCCACCCCGG + Exonic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1164632394 19:29770102-29770124 TTGGACCCACACAGGCACCAGGG + Intergenic
1165361860 19:35341707-35341729 ATGGACACACGCAGCCTCCTGGG - Exonic
1165761556 19:38324499-38324521 CTGGAGCTACACAGCCATCTTGG - Intronic
1166640805 19:44493631-44493653 TTGGTCACACAGACCCACCTTGG - Intronic
1167633864 19:50642117-50642139 ATGTAAACACACATCCATCTGGG - Intronic
1168099071 19:54131428-54131450 TTGGACACACGCAGTCATTCAGG - Exonic
1168585986 19:57592400-57592422 TTGGACATACACAGATTTCTAGG - Exonic
925080882 2:1065106-1065128 CTGGAGCCACACAGCCATGTGGG + Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
925333185 2:3074553-3074575 TTGGTAACACACACCCATGTGGG - Intergenic
926780224 2:16463793-16463815 TTGGACACTCTCACCTATCTGGG + Intergenic
927865014 2:26582706-26582728 CTGGAAACTCACAGCCTTCTTGG + Intronic
928702718 2:33915549-33915571 TTGAACACAGACACCCACCTGGG - Intergenic
933318407 2:80742337-80742359 TTGCACAAACACAGCCATGGAGG + Intergenic
936492082 2:112980868-112980890 TTTGACACACATGGCCACCTTGG - Intronic
938962215 2:136354068-136354090 TTGGACACACAGAGATATCAGGG + Intergenic
939422957 2:141997372-141997394 ATGTACACACACACACATCTTGG - Intronic
939631834 2:144534822-144534844 TTGGACACAGAAAGCCAGCCTGG - Intergenic
940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG + Intergenic
942142680 2:172993721-172993743 CTGGCCAGACACAGCCCTCTGGG - Intronic
944161128 2:196661430-196661452 TTGGACACACAGAGACACCAGGG - Intronic
946479836 2:220044483-220044505 TGGTGCACACTCAGCCATCTGGG - Intergenic
947486031 2:230549841-230549863 TTTGAGTCACACAGCCATTTAGG - Intergenic
948606696 2:239140472-239140494 TTGGGCACACACATCCACCGTGG + Intronic
948897741 2:240935106-240935128 TGGGAGACCCACAGCCACCTGGG - Intronic
1170664900 20:18378365-18378387 CTGGGCCCACAGAGCCATCTGGG - Intergenic
1170702785 20:18718699-18718721 ATGCACACACACACCCCTCTAGG + Intronic
1174398869 20:50265029-50265051 TTGGACAAATACAGTAATCTGGG + Intergenic
1174679221 20:52388743-52388765 TTGGACACACACAAGTTTCTAGG + Intergenic
1175760868 20:61561477-61561499 TTGGACACACGCAGGCCACTTGG - Intronic
1175822038 20:61915248-61915270 CTGAACACACACAGACACCTTGG - Intronic
1176920526 21:14682733-14682755 TTAGATACACTCAGTCATCTAGG - Intergenic
1179294918 21:40053247-40053269 TGGGATACTCACAGACATCTTGG - Intronic
1181339502 22:22166507-22166529 AGGGACACACACAGCAATCCTGG - Intergenic
1181788170 22:25242684-25242706 TTGGACAGAAACTGCTATCTCGG - Intergenic
1181867600 22:25871293-25871315 ATGGATCCCCACAGCCATCTTGG - Intronic
1182175279 22:28279682-28279704 TTTGACACACACATACACCTAGG + Intronic
1184775831 22:46622245-46622267 TTGGACACGCACAGAACTCTTGG - Intronic
1185105953 22:48869967-48869989 TGGTGCACACGCAGCCATCTTGG + Intergenic
950778962 3:15374767-15374789 TTTGACACACATGGCCACCTTGG - Intergenic
951660690 3:25061569-25061591 TTGAACACAGACAGCTTTCTTGG + Intergenic
952512205 3:34069070-34069092 TTGGACTCTCACAGCCTCCTGGG + Intergenic
953387733 3:42516198-42516220 GTGGGCACACACAGCCAGCCTGG + Intronic
954867720 3:53744052-53744074 CTGGCCACACTCAGCCACCTAGG + Intronic
956877339 3:73476554-73476576 TTGGTCACACACAACAACCTTGG - Intronic
956974052 3:74559580-74559602 TGAGACACACACAACCAACTTGG + Intergenic
960028576 3:113035382-113035404 ATGCACACACACAAACATCTTGG - Intergenic
961170323 3:124793255-124793277 ATGGACACACGCAGGCTTCTAGG + Intronic
961357090 3:126346083-126346105 TGTGACACACACACCCATCCAGG - Intronic
961564852 3:127756109-127756131 TGGAACTCTCACAGCCATCTTGG + Intronic
962443538 3:135444994-135445016 TTGGACACACAAAGCAAACCAGG - Intergenic
966910907 3:184559484-184559506 CTGGACAAACACAGCCAGCCAGG - Intronic
969590304 4:8118229-8118251 TTGCACACTGACTGCCATCTGGG + Intronic
971137422 4:23884828-23884850 TTGGATACAGACAGCTTTCTGGG - Exonic
972559383 4:40213387-40213409 TCTCACACACACACCCATCTTGG + Intronic
976671254 4:87656620-87656642 TGGAACATACACAGCCATCTTGG - Intronic
977303887 4:95299212-95299234 TTGGACACACAGAGACACCAGGG + Intronic
978292004 4:107152731-107152753 GTGTACACACACAGCCAAATAGG + Intronic
979967648 4:127094720-127094742 TTGGACTCATACAACCATGTAGG - Intergenic
980548340 4:134299594-134299616 ATTGACAAACACAGACATCTGGG - Intergenic
982448220 4:155519995-155520017 TTGCACAAACAGTGCCATCTAGG - Intergenic
984706761 4:182852878-182852900 TTGGACACAAACAGGCATAGAGG + Intergenic
985080250 4:186257796-186257818 TTGCACACACACAGCACTTTGGG + Intronic
987685260 5:21190205-21190227 TTAGAGACCCACAGCTATCTTGG + Intergenic
988702475 5:33689095-33689117 ATAGACACTAACAGCCATCTGGG + Intronic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
989288398 5:39731367-39731389 TTGGACACAGACATGCATATAGG + Intergenic
992101367 5:73410702-73410724 TTTGACACACATGGCCACCTTGG + Intergenic
992381455 5:76241721-76241743 TTTGACACACATGGCCACCTTGG - Intronic
996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG + Intergenic
997353864 5:133249776-133249798 TTGGACTCACATAGCCTTTTGGG - Intronic
998575610 5:143312258-143312280 TTGGCCACACAGACCAATCTTGG - Intronic
998935460 5:147228340-147228362 TTGTACACCCACAGCGATATTGG + Intergenic
1000064398 5:157682600-157682622 AGGGACACACACAGCCTTCCAGG - Intergenic
1001982560 5:176046901-176046923 TGGGACCTACACAGCCACCTGGG - Intergenic
1002234901 5:177797156-177797178 TGGGACCTACACAGCCACCTGGG + Intergenic
1002261161 5:177994971-177994993 CTGGACACACACGACCACCTGGG + Intronic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1005816826 6:29559788-29559810 CTGGACAAACACAGCAATCCAGG - Exonic
1006439566 6:34045519-34045541 TTGGACAACCAAAGACATCTGGG - Intronic
1007407469 6:41643291-41643313 CTTGACACACTCAGCCATCTGGG + Intronic
1007697736 6:43744396-43744418 GTGCACACACACAGCCAACTGGG - Intergenic
1009366518 6:62861360-62861382 GTGGACACCCCCAGCCATATGGG - Intergenic
1009996533 6:70901477-70901499 TTTGACACACACACCAATGTGGG - Intronic
1010727702 6:79354157-79354179 TTTGACACACATGGCCACCTTGG - Intergenic
1011221768 6:85062109-85062131 TGCGACACACAAAGCCATTTTGG - Intergenic
1011614895 6:89188839-89188861 TTGCACACACACAGACATCCTGG - Intronic
1012615383 6:101271916-101271938 CTGGACACACACAACCTACTAGG + Intergenic
1012653399 6:101785310-101785332 TGGGACACAAAAAGCCATATGGG - Intronic
1012914587 6:105155890-105155912 TTGGCCACACATTGCCATCATGG - Intergenic
1014434772 6:121409088-121409110 TTTGACACACATGGCCAGCTTGG + Intergenic
1015711469 6:136146083-136146105 TTGGTCACTCACTGCCATCAGGG + Intronic
1017328930 6:153172973-153172995 TGTGACAATCACAGCCATCTGGG - Intergenic
1020989553 7:15179954-15179976 TTTGCCACTCAGAGCCATCTTGG - Intergenic
1022415481 7:30173335-30173357 TGGGCCACACACAGCACTCTTGG + Intergenic
1022842276 7:34176085-34176107 ATGGACACACATAGACATCAGGG - Intergenic
1023639073 7:42239341-42239363 TTGGAAACCCTCAGCCATCCTGG - Intergenic
1026482220 7:70789415-70789437 TTGACCACATGCAGCCATCTTGG + Intronic
1028603117 7:92624381-92624403 TTGGACACAAAGAGACATCAGGG + Intronic
1028684521 7:93576311-93576333 TGAGTCACACACAGCCCTCTGGG - Intergenic
1028846072 7:95481694-95481716 TTGTACACAGACAAGCATCTGGG + Intronic
1029986592 7:104928475-104928497 TTGGACACAAACACACATATGGG + Intergenic
1030641385 7:112010461-112010483 TGTGACACACATAGCCACCTGGG - Intronic
1031449168 7:121893257-121893279 TTTGAACCACACAGCCATTTGGG - Intronic
1032503636 7:132418966-132418988 TTGTAAACACAGAGCCTTCTGGG + Intronic
1034818820 7:154198072-154198094 TTGCACATCTACAGCCATCTGGG - Intronic
1035370260 7:158375431-158375453 GTGGCCAAACCCAGCCATCTCGG + Intronic
1035528978 8:336555-336577 TTGGACACAGACAGACACATGGG + Intergenic
1037024348 8:14014638-14014660 TTGGACATTTTCAGCCATCTGGG - Intergenic
1038340992 8:26684783-26684805 TTGGACACAGACACACATATAGG + Intergenic
1042965621 8:74348863-74348885 TTGAATTCCCACAGCCATCTGGG + Intronic
1043252926 8:78098456-78098478 TTGGACCCTCACTGACATCTAGG + Intergenic
1043483844 8:80679410-80679432 TTGGACCCATGCAGCAATCTGGG - Intronic
1043548977 8:81347407-81347429 ATGGACACACACAGACACATTGG + Intergenic
1044824658 8:96184534-96184556 TTGGACACACACTGAGTTCTAGG - Intergenic
1045337497 8:101221753-101221775 GTACACACACACACCCATCTTGG - Intergenic
1046621129 8:116530864-116530886 TTTCAGCCACACAGCCATCTCGG + Intergenic
1048314895 8:133354668-133354690 TTGGACACAAACAGGAATCCAGG + Intergenic
1049094349 8:140539690-140539712 TTGCACACACACAACCTCCTGGG - Intronic
1050406323 9:5312182-5312204 TTTGACACACATGGCCACCTTGG + Intergenic
1051295362 9:15589184-15589206 ATTGACACACATAGCCACCTTGG + Intronic
1054813304 9:69451814-69451836 TTGTACAAACACTGCAATCTAGG - Intronic
1054920905 9:70541346-70541368 TTGAACACACCCAGCATTCTGGG - Intronic
1056180665 9:84079297-84079319 TTTGACACACATGGCCACCTTGG + Intergenic
1057247808 9:93472511-93472533 TTGGACACACAAGGCCAGTTTGG + Intronic
1059965665 9:119610998-119611020 TTGGAGACACTCAGGAATCTGGG + Intergenic
1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG + Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186938163 X:14474081-14474103 TTGTACACACACAGCCACTTAGG - Intergenic
1187075491 X:15930200-15930222 TTGGCCACACAAAACCACCTGGG - Intergenic
1187938005 X:24354518-24354540 TTTGACACACATGGCCACCTTGG + Intergenic
1188650091 X:32621687-32621709 TTGCACACACCCAGCCATTCTGG - Intronic
1190107464 X:47570463-47570485 ATGGACACCCACAGTCACCTAGG + Intronic
1190193427 X:48296290-48296312 TTGGAAACACACAGCATCCTGGG + Intergenic
1190634848 X:52423784-52423806 TTATACACACACAGCTACCTTGG - Intergenic
1192130379 X:68544060-68544082 TTGGCCTCTCACAGCCATCTTGG - Intergenic
1197166100 X:123379319-123379341 TTGGACACACAAAACCCTCATGG - Intronic
1198211349 X:134519247-134519269 TTGGACACAGACACCCATAGAGG - Intronic
1199685060 X:150258279-150258301 TGAGACAGACACAGCCTTCTTGG + Intergenic
1199999595 X:153051854-153051876 TTTGACACACATGGCCACCTTGG - Intergenic
1200203984 X:154302809-154302831 TTGGAGACACACAGACACCGTGG + Intronic
1200272430 X:154698582-154698604 TTGTAATCACACAGCCAACTGGG + Intronic
1200698876 Y:6385445-6385467 TTGTACAGACAGAGCCATCCTGG + Intergenic
1201035236 Y:9779254-9779276 TTGTACAGACAGAGCCATCCTGG - Intergenic