ID: 1185620000

View in Genome Browser
Species Human (GRCh38)
Location X:1448169-1448191
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 17, 1: 19, 2: 26, 3: 16, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185619995_1185620000 4 Left 1185619995 X:1448142-1448164 CCGCCATCTTGGATAAGCACCAC 0: 9
1: 4
2: 5
3: 28
4: 157
Right 1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG 0: 17
1: 19
2: 26
3: 16
4: 133
1185619996_1185620000 1 Left 1185619996 X:1448145-1448167 CCATCTTGGATAAGCACCACCAT 0: 16
1: 21
2: 42
3: 78
4: 178
Right 1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG 0: 17
1: 19
2: 26
3: 16
4: 133
1185619993_1185620000 20 Left 1185619993 X:1448126-1448148 CCATCTTGGACACACACCGCCAT 0: 19
1: 27
2: 46
3: 99
4: 214
Right 1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG 0: 17
1: 19
2: 26
3: 16
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901383915 1:8894059-8894081 TTTGACACACATGGCCACCTTGG + Intergenic
903876254 1:26475428-26475450 TTTGACACACATGGCCACCTTGG + Exonic
905451340 1:38058771-38058793 TTGGACACACAAGGACACCTTGG - Intergenic
906054072 1:42900549-42900571 CTGAACACACACCGCCACCAGGG - Intergenic
906137567 1:43510266-43510288 TTGGACATCCTCTGCCATCTTGG + Intergenic
907056343 1:51372241-51372263 CTTGACACACACCGCCCACTAGG - Intronic
908647947 1:66300036-66300058 TTGCACAAACACAGACATCTAGG + Intronic
909495976 1:76279163-76279185 TTGGACACACACAGCCAGGCAGG + Intronic
915336937 1:155149407-155149429 TTTGACACACATGGCCACCTTGG + Intergenic
922952544 1:229571084-229571106 TTTGACACACATGGCCACCTTGG + Intergenic
1063377268 10:5561810-5561832 TTGGAGTCACTCTGCCATCTTGG - Intergenic
1063685486 10:8233442-8233464 CTGGGCACACATAGCCATCTAGG + Intergenic
1070415847 10:76188544-76188566 TTAGACACATTCCACCATCTGGG - Intronic
1075192984 10:120328571-120328593 TTGGACATAAACAGCAATCTAGG - Intergenic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1081059941 11:38461876-38461898 TTGGAAACGCACACCCATCTGGG - Intergenic
1081751556 11:45514725-45514747 TTTGACACACATAGCCACCTTGG + Intergenic
1082044825 11:47716318-47716340 TTGATCACACAGCACCATCTGGG + Intergenic
1085074736 11:73580791-73580813 TTTGACACACATGGCCACCTTGG + Intronic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG + Intronic
1098379250 12:69851798-69851820 ACAGACACACACCACCATCTTGG + Intronic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1103504212 12:121430330-121430352 CTGGACACTCACAGACATCTCGG + Exonic
1114511289 14:23263609-23263631 TTTGACACACATGGCCACCTTGG - Intronic
1117413390 14:55471003-55471025 TTGGACACACAGACCAATCTTGG + Intergenic
1117941524 14:60971958-60971980 TTTGACACACATGGCCACCTTGG - Exonic
1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG + Intergenic
1124445858 15:29731262-29731284 TTTGACACACATGGCCACCTTGG + Intronic
1124553996 15:30708918-30708940 GTGGGCACCCACCCCCATCTGGG + Intronic
1124677251 15:31696753-31696775 GTGGGCACCCACCCCCATCTGGG - Intronic
1132179220 15:99739191-99739213 TTGGATACTGACGGCCATCTGGG - Intergenic
1135858295 16:26032239-26032261 TTTGACACACATGGCCACCTTGG - Intronic
1137062329 16:35802612-35802634 TTTGACACACATGGCCACCTTGG - Intergenic
1147383110 17:40067244-40067266 TGGGACACACCCCACCAGCTAGG + Intronic
1147753567 17:42753233-42753255 TTTGACACACATGGCCACCTTGG - Intergenic
1148496822 17:48058040-48058062 TTGGCCAGACTCCCCCATCTTGG - Intronic
1149948715 17:60960819-60960841 CTGCAGAAACACCGCCATCTTGG - Intronic
1150171824 17:63004404-63004426 TTTGACACACATAGCCACCTTGG - Intergenic
1153837498 18:8977094-8977116 TTGGCCACACCCGGCCACCTTGG - Intergenic
1155542592 18:26884051-26884073 GTGGACACCCCCCGCCATATGGG - Intergenic
1155542615 18:26884129-26884151 CTGGACACCCTCCGCCATATGGG - Intergenic
1155824183 18:30418383-30418405 TTTGAGACACACTGCCATTTGGG + Intergenic
1160016436 18:75144390-75144412 ATGAACACACACCCCCATGTAGG - Intergenic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
935746835 2:106196215-106196237 TGGGACACCAACCGCCTTCTGGG - Intergenic
936492082 2:112980868-112980890 TTTGACACACATGGCCACCTTGG - Intronic
936882419 2:117269962-117269984 TTGAACACAAATCCCCATCTTGG + Intergenic
939003699 2:136763623-136763645 CTGCACACACACCCCCATATGGG - Intergenic
940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG + Intergenic
942577299 2:177377706-177377728 TTGCACACATAACCCCATCTGGG + Intronic
944663292 2:201938918-201938940 TGGAACAGAGACCGCCATCTCGG + Intergenic
948388784 2:237597770-237597792 TTGGACACAGGCCTCCATCCAGG + Intronic
1169401216 20:5282357-5282379 TTGAACACACACCCCCCACTGGG + Intergenic
1174399911 20:50270368-50270390 TGGGACACCCACCGTCATCCAGG - Intergenic
1178994593 21:37387076-37387098 TTGCACACCCACCTCCATTTAGG - Intronic
1181788170 22:25242684-25242706 TTGGACAGAAACTGCTATCTCGG - Intergenic
1185373177 22:50470165-50470187 TTGGCCCCAAACCACCATCTGGG + Intronic
950778962 3:15374767-15374789 TTTGACACACATGGCCACCTTGG - Intergenic
969590304 4:8118229-8118251 TTGCACACTGACTGCCATCTGGG + Intronic
974990763 4:69085753-69085775 TTGGACACATACCACCAACCAGG - Intronic
976671254 4:87656620-87656642 TGGAACATACACAGCCATCTTGG - Intronic
982448220 4:155519995-155520017 TTGCACAAACAGTGCCATCTAGG - Intergenic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
987821271 5:22970039-22970061 TTGGTCACAGATCCCCATCTTGG + Intergenic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
991767688 5:70004957-70004979 TGGAACACTCACCGCCATCACGG + Intergenic
991846922 5:70880033-70880055 TGGAACACTCACCGCCATCACGG + Intergenic
992101367 5:73410702-73410724 TTTGACACACATGGCCACCTTGG + Intergenic
992381455 5:76241721-76241743 TTTGACACACATGGCCACCTTGG - Intronic
996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG + Intergenic
1002261161 5:177994971-177994993 CTGGACACACACGACCACCTGGG + Intronic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1005706075 6:28454838-28454860 TTGGAGACACAGCACCATTTAGG + Intergenic
1006076392 6:31535250-31535272 TTGGGCACAAGCCGCCTTCTTGG + Intronic
1007407469 6:41643291-41643313 CTTGACACACTCAGCCATCTGGG + Intronic
1007697736 6:43744396-43744418 GTGCACACACACAGCCAACTGGG - Intergenic
1009366367 6:62860814-62860836 GTGGACACTCCCCGCCATATGGG - Intergenic
1009366415 6:62860974-62860996 GTGGACACCCCCCGCCATATGGG - Intergenic
1009366438 6:62861055-62861077 GTGGACACCCCCCGCCATATGGG - Intergenic
1010727702 6:79354157-79354179 TTTGACACACATGGCCACCTTGG - Intergenic
1010917455 6:81637861-81637883 TTGCACTTACACCACCATCTTGG + Intronic
1011614895 6:89188839-89188861 TTGCACACACACAGACATCCTGG - Intronic
1012914587 6:105155890-105155912 TTGGCCACACATTGCCATCATGG - Intergenic
1014434772 6:121409088-121409110 TTTGACACACATGGCCAGCTTGG + Intergenic
1015711469 6:136146083-136146105 TTGGTCACTCACTGCCATCAGGG + Intronic
1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG + Intergenic
1038637661 8:29300550-29300572 TTGTACACACCCCGCGATATGGG + Intergenic
1042065406 8:64869536-64869558 TTGGACACATAACTCCACCTGGG + Intergenic
1043252926 8:78098456-78098478 TTGGACCCTCACTGACATCTAGG + Intergenic
1044824658 8:96184534-96184556 TTGGACACACACTGAGTTCTAGG - Intergenic
1050406323 9:5312182-5312204 TTTGACACACATGGCCACCTTGG + Intergenic
1054813304 9:69451814-69451836 TTGTACAAACACTGCAATCTAGG - Intronic
1056180665 9:84079297-84079319 TTTGACACACATGGCCACCTTGG + Intergenic
1057247808 9:93472511-93472533 TTGGACACACAAGGCCAGTTTGG + Intronic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG + Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619209 X:1443055-1443077 GTGGACACACACCGTCGTCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619214 X:1443093-1443115 TGGGACACACACCGTCGTCGTGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619333 X:1443862-1443884 GTGGACAGACACCGCCGTCGTGG + Intronic
1185619336 X:1443881-1443903 GTGGACAGACACCCCCATCATGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619956 X:1447876-1447898 TTGGACCCATAACACCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620025 X:1448350-1448372 TTGGACCCATAACACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186938163 X:14474081-14474103 TTGTACACACACAGCCACTTAGG - Intergenic
1187938005 X:24354518-24354540 TTTGACACACATGGCCACCTTGG + Intergenic
1190250140 X:48717137-48717159 TGGGACACACACCACCAAATAGG + Intergenic
1191692222 X:63952387-63952409 CTGAACACACACCCCCAACTGGG + Intergenic
1192130379 X:68544060-68544082 TTGGCCTCTCACAGCCATCTTGG - Intergenic
1195579180 X:106482268-106482290 TTGCCCAGACACCTCCATCTTGG - Intergenic
1199999595 X:153051854-153051876 TTTGACACACATGGCCACCTTGG - Intergenic